%PDF-1.5 % 1 0 obj <>>> endobj 2 0 obj <> endobj 3 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 4 0 R/Group<>/Tabs/S/StructParents 0>> endobj 4 0 obj <> stream xXK#7tQ3/,$drZB,$kmNiT_Uuav4_|6߾` y} 9.oмe/`LΙ~`^>I~a08py,5D<ȵN+[c?sಥ\Tsu"zJLȊ S7Rk& Q^S}އwgݨ =H}Y}<˭mN[$h,+@TM892^y}JC<\4t9]50v Dv$t&vt.]T'rX(URJ6 u.f"졏)?G0 }y%h:|FRfxƬΗ,Q,% g:uC;R5f C~/aR6Lo-9ԃ- *%%ǵ+bt&ȴlRJ>Y a+$F-H D[FHJ8o'-x&DZ P6AÍ[ oa.A\,O񐰦]u#!r#܂?%^%4Rk_kDk{JD ?m ȫ endstream endobj 5 0 obj <> endobj 6 0 obj <> endobj 7 0 obj <> endobj 8 0 obj [ 9 0 R] endobj 9 0 obj <> endobj 10 0 obj <> endobj 11 0 obj <> endobj 12 0 obj <> endobj 13 0 obj <> endobj 14 0 obj <> endobj 15 0 obj <> endobj 16 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 17 0 R/Group<>/Tabs/S/StructParents 1>> endobj 17 0 obj <> stream xŜId`Z,5H # }*pijd?F/y~×_H=?g^9 0˟n_aHZ=lk5VqWLVz$9B3)O)nN -D%nfS.\zyᒹ7my8 wL[1QV;IJ6ZICwNHBrT*ɭ2hp^W ꥧy΍\*C.pp.m1/bCn}UvS>Jl{Ym ̎Rׇ0Lx06CaU=1զG?|{Sj|SrWQ{ao^zt255ofFˠSʹu6=һt/ٻ ur1qwm\VQޚs2:4R?䪙OX:V4"4? Ņ k ֍jpS7? s:}bAbj9ӳAd[2ر>? !Zpwy}~8K6묎i?_<|񗗿c#CJ/~3aʍZ A@Jn|7Ǣv^B#Gqe"pEd\ih'Q|}eI8jQ @P.aڳ :1,y"=wW ~@I(Z{ L6(yn`%6(>Ij5F9Mq%h%ð8rcrq|R|(~_V)Y븤|O\8g b¸J|⣳qWTavz{dk8-D{qUX\LߧPrֆdO/+\B,󨗹īq|-cj$3pJRMK(W8/ hC[pjTґ[i]y>| Qg4RJF֤χ@f lV^oW^QXg|Nqi$__l-ֆY6-8Hh`%=%gɬZ*1%X~fU}ӌU &6~;Wqc\6f(a݅zM4+Yh5apqp>1pF<"geٍ0)p9)&~r07*x-=NY9vhM5Ŝ 3)T"/.Vف޸ 4ox8eTpA Cԕu aL J$b(ZƩQr3lDlI1L ɘS,c3/i̹6+2/T`L Q <*H)PdGףC Cֆ"!p8fDANA8Hs.}uN-H2:`[), !"+&)VR:GW_!oIzPFhArnj%g 1#kVΤ_ ėCgcaɀ^;۷8 i7Qč>&8&j preoX*M!Zܣr얆܃"6%]rTl=Ey%E{JeI)pO*sT{bOe'{=JgsO =SƯZ8g.W :T,$;O%d#oo u2[.Nm]Z#H)LMKx.ĭ`VZ~vjw Ϯ*/F2>4ywVN; .1=ts{:W&@&ՕB {w}cJ"M3ùCĔT‚aa<|36ں QO{:+yy^ DLdĂly [!(o{anv3u 3`ث.aF݁C8PàQ}rw p37N o2c T3[,vBmvp펴R1Djp3v@1BIRǐ'my;~V[Sբ̀' B"EyZR3DDDf  27UW7? yɭY",g*H*`)ͥNe4QvSs ,t* \iN 2T0EWKFnCQD&=MGR,eSdPkq35}#MÿCD}7Άғf&ܝۥ>sEb!Z%`--Ua1 m;`hvtJ"E4Ph&@LTMh vv{iN}"s;Q'Z2_Ϫ;*fU]tؑͶ,2i*u*m7DmáM?qF endstream endobj 18 0 obj <> endobj 19 0 obj <> endobj 20 0 obj <> endobj 21 0 obj <> endobj 22 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 23 0 R/Group<>/Tabs/S/StructParents 2>> endobj 23 0 obj <> stream x\Ko$ ʀzY|6y)H`1 # }⣻MHkf+V:<=}2z_``? JFQ?w|x};6^tpß_7R_np2 6ujGixXgy~^ PK?,z(" a`zxOQ˦P q*`:=N<Տ&d6YQ/SnS{Rvvvs&G>׶`3bfgD %yAg)Vfj ]5e1' Q/1E';jNs) cY}malc^. v bTSAq|y8$Уʖjd0[$%H $i30Ͽ=ooheT6@G|9 Fvdf|7j֯q(pLԣ҉::%&rdr, MXkvkk:d*XLN-(U.VkiF;duBH\QZrNqXz7 ن8YTS\O#W{=r ?Ho6AFzP0qnyP (Mԓ6]&90zɞpqR1!aŊCNϏ;M-"!K3Q1qƂyEvgntw}"a3"q3 ęE 9)HOKR$^H!ķWUܪ>M?5q`ӿ2ޖ̼zbTs™oVՓ^el9CAI֎@B5q׏@63r^3}2&3bN#K! 2v9걩1b-3+A$+p& >B UYY*X}&k$(Jm\=Oabr3#%G?7B{^mހS=% ~@`-c^puu 07}NϊI/fWy}/gޓp;yF{WrtphFhaTaLa Wp1ap'v'~3 wȋg58@;ѱ HoNo7)*\`ާS@f-WXS4H$A$dxDw*PLծZRhN("j7:^ꚺ<NlkBnmɏq W^O,Wi|6DKDZYRBb2*b۵*ه-7ҽ^>`uHife FodeX3 =#\yumdQWPl/Q=xeRzym&3F*(hnAu8@S":3v̞u!GbN)ͷĶbL/դw=@+zj=Ê(he(uu% ş+AzBvwFnᶹI@7tkvI"zsh͎&m;&9j&3D(D e=t"^$6u'7*^ RHklS̡S)+.J ,d%D£WUd  8NyO硬̝] %v̍SiMHY#-釬ÆVq$dK;ʐhsfbyxp.^^'wn_'Ĥ"kpÐ 79EȹeOEC5̆*:I w36n(wm*NPtwR PO(EwWUT?)%"$ 8D·BU(B[+x04a6Glj78ޅo Ybcl 3[+J{ٵxe% 90s$UR;Ӽ"f3︮r1\Vl Nt^U9.Mf*ALYad%G$Z K!bƜ=ʤ>3LDU]6̑.QB_1@@WGdLZYшJ$7Q&Uȫ3wfzEᣎSq^2g[_4AIE"̖ O )\(P۔^dSPjыJRkȎND)::1ALS<yPɩH4t $9٧~w/7 b8!5;;}[09Pr0r:9 [G VLSs߂ M|@-~:o|*Gs=9;Xv{xℸ`'0=c)4Oױt2#]Gm;޴@2|Cv[KM3~4%'޶$VLU4bvo+fҚ-23.Ȥ"}cvo+ffױ]bv C cZFf6v Dc| iu[HКLqJh =oDTǑȐp0vv3GĸeSii6nufY-{Ev47l.;%|!cPx7ڈ]%2Q"3"t#,ŋ42ުxAUTƋA'!J> endobj 25 0 obj <> endobj 26 0 obj <> endobj 33 0 obj <> stream x[ێ}y'A. @,G5]ς\@0!BT0>beAFxXϵńa0YN+jOX#c;|ac^7qx'lָ)nVϴa3+~Jq_'i'}xb0_y+&u7kUidǞv7_o߽D5|d ]D/?C5K2׽c*2ԍT8e_[6Yʑ٪Y_ T2I/Cσ2 \u=|uZ[-|'Le i+ZLGU0R08fIݒ׃`afh ==.#x5PW;㩎TU<⽢T.SOe<IݲxZN>]vC UP`+ǾM&g9Ḧ́$X>*Vx3gHPg:^ݴ 16SA>4O5lk-w7ykK^ɪvcmzY/)Hkmq̀Gֺvb0/lLc㳉s+˵pf' s Ȝ 2fdGU Ovf0 Ȝ Ȝ2dNYYޑhjGC+W:<;-/yXXoo}(d{ɮ/:4n媲%RU㏭rN<OcxgQFIQUoTZwf3bYtE%Im[3㤻Yƫ"QXRV718vRNdAj0] L.fNj׮ -:63_yvfl9ߨW^Y^ayXר#*B!Y:Y"m[ZTTxX[4+Tc+vmcҨ(+۪Fd HbeC_6^ߏ.ĭj xgjJժjՊ걪QWGUx+G 9`vڝq ǃgE-I?,TUc|I6'})tsi\J+U":*F5&K* ]Zw۩j*Zno]㸊=#\'G2s=ݿvx-hjכV:uׅJ/ԍW^~[ר,{q xHc7C]򪸢QZՒuryRj=<zu]C2m=ݿvdzUV?v+dO`ʏ1ܿtx3;ovvts#=imy#cn65/72K 0KgH!mEpZCi2dĻayW#'unwW#ih=_regȺ;|xśϷ'z/o?~ߋ~;{^l$cAG#:Gͳt|Ii9q߅1/x1i'^v2K;gWd4u#榖\!ωw2K=vvJ~PsiyeԨq"GV[gNICcڗuzq]ZN=ZPџ*G'gG('Ts߬\~N1 ⥳zBE܌~^oP+ЗN 'ˑ͔Y^ڐ*4\}|BE?L endstream endobj 237 0 obj [ 500 0 0 0 0 0 0 0 0 0 0 0 0 500 0 0 500 500 500 500 500 500 500 500 500 500] endobj 238 0 obj <> stream x}xT՝Od&L7H&0T[bJHB$dBkVPw}[n_(>$g[-lKPZ}X<1w&!X]~?=ܗssMHQ2X~MHY"~'Yk:; }@\vc֡ 觟"h]}uWޞ"K8oXW}ߩDC*\ 9_h{pMtvl*&LtMv>?ߝĩDCc ud9{?/|Z\_ٮبךnv/e~[c?zH"i#c#T#h-'+BK +vJd%J"6,h dac[ǹFVZr6) #v$HL4h6 SvqΧ=Uϛ햻dD}3IDهIS"ƛTd|\(+{Dp$'U_qA6O?|}i:aIw/퟊8 pzf:7BM4O]4H;Ƹ$%-K^-^W^u˓ի80!¤T/LzK{{y-}o 1,vIf\5,'sPbT'x4lg%;+Y8JvVY"sVh EC_RM{k 52ԕbRJcb]B娍3FN5< Tlw󑛸}4345E6؛ߙ3xn ZvwVړb/xJ*r ~$~"~6ĽEp{ا|g]5,.=\^!!r6.?7??}4OhiR:{άHXdZg. CM2tU]89%ۼLq내6s$\=)'q/iqs-hi"mEj[&%&Iu^)L՜}RҞVCT ҉LE(pV6Z˫^)?*S+.Ί\.n(G2F=_T!uXZ<>?v-u/-]UUay5u|>6EfB>4XrښiZv*yU_GxLtftqTGdpZ 6-Gc>:z[Ѿӎ6n#=>`~MRSbrU*M.H.OސHLI~6HIXR$+~(^ɤiXdx2ҟ13-9?9j;Νo;q;gmk3N9I}B;8Kϴ< *T s{*y.iy5 !of(h<艻+27R D5*⑲&Lk۬ȬHNz.sed`1]cjuhf8?Btw.}'FcCtCbP wDHX;,zJۡv$Gh#m-F9ɉ#Rg==EC])Zm~ԫ%JYh2LGːy]5D<\nxu|kt|nދ!aXz1w6}ՂOUHsK+NIm ϥ!'O-tqgpKX gk#WOLmG)R.Qz`L/OYWeB,D#kN;甡,+NHrS%Љ/7xvĶ7DS;>P_r5K* l Ӽ.ZZm\]vmHo "99Z.STL!9Ws(\|8y ys(?d392Z\MFKv4o.6ߛ0N:K ?jf2O++!^IUF%5|S4VW&,kYXv{ l~ӯysdpS鼺~9jߩ_zfF]"PYbzAUiHS*IU䔬/J*͉Rn]=VNpü7ӧsݺԡt;};T5*=>=82w:oF?x<."XtI~,,բZ Tj^sf”<$|8*ccٙ}.,ͱىh36;>Ӿ=qX;^l+6ٴ9nό?06O̧馉{(=ys~GS81{䒑_AccBLƹf<+޶Sd{7ynMQ$cc/v٢%\Jccq{pxl^ZbY6kQqnklY[&l}U6Y7Y>eieZ[^>~>c=d}zizZ^Fc-ǭ֭mV ?p˖(EcL!$)*--c8."'ĿxA$FOěR\JHRFjIMRV!])mia#?IGc3ҳ)GҋҏJKq\NȕrFL1{ endstream endobj 239 0 obj <> stream x}nGE .w7 'Eȑ# J^u/\H=8553W޶W^vw?/_Ou~y:lvogj.{}[o/՟vz~zz:|~Mz<>o >\_u^~_2ncln񛻪fϋ,?&c5\![$Es{_A ׅl_ h)l&eR%a,H[R#5/ S@!l:Wե2Ȣy.\wg:*!9if:cg\mX" (1Ky(QRIrqG.!HNYhSb@SH?d݅N!/ ȆΩꅢΠIV)2BPal\.y` vH6ci @uXq𬳢Ӧ5hhR$!l],)ζJHak jUTy(B$d֩nàڴHL3; ;(pb{Pg aJʤN꠆K$zfzv,5czV+z* fkiq?^e RC^ 5e،{o;/N-r"r+)䆌k} /m6!Z-H oArBHOw y#xH (jP-Ifo0èR; UJET[:= <+; JUͩwμ RxLxv4(d:*zy| #XRմ⺂uzWTH+64}MM 6+'m=zZPa:fe]0벑v@VpI4@6M(aKUj >JOlhx9]Bw4Ԏw!4=H4jA%P %!aƺ:6x O;P{Rq ={ %R"5R6/Gqˑy"m]t$rR 4PCv`Z41Dރtkpb1&EY)H}*Ed^bϤJAJϑHReG%bH$gkCMkR h֬hfm=Y*FWZe.ڈI c3&a`2%+iLnUuPGU[@.5H[T[yMJ$*Q܂W9&ewq.ʫ||}='>c-!_O(6 endstream endobj 240 0 obj <> stream x̝[euOܾ{zfM/_??>){l2Wʍ/?>寽+qRڟݴ_|_|yr}2w7};?_pR~}:Ư|/̿yy7M>wy_z/7>o~ų_=_\~ۛ7~ŗOM&;_|ki2_~nη6ʿ7_}k_NkrΤg0kd~}?Gxk?x_ojk_v>}WymLܼXnɫW&NW':nw3ca?yk?}I-LvĤ!AaynS7e){r妼)}nf?ɵMYl*VQ><)o:}MoS7ewSvZON/ 릁G}6U۾qSC1teʦ4Ƹ5|~S4t9n'7'7<)|S(Q*Jomŗ9弁G'7坛Myצ%ޔoOmvܿ/X޺)saSD76 ߔnʟؔnʇ7#SѦ|& {y&q%`Vzuۂb|ODQQjhWi8 c1:O݇|8QhxBNMtS))6[o~ȳƦ\+wg U7MԺT]>ڔ/KlՀ}#nۢD(߈]Y?._W~4W-K~a{x^{/r;J˪W@YFy.dRI޻)#b߈럎&fk߉>>nW[6Y;x_>cq_W{v\ q0)UOCóq=wף3N u|0ϢݵJԟGy{xCx[( (O*'j/NMAo? ^| r+B|2;ڷ6AW?V{(Sg/:(JA[B޺~0׹裁K{^z.J7?4_:~o\?Ļw1Y~s܋ߧz'1p\oj~_/_՗6?|_pe3zUFa'_UZRq} ^a<ܵ[Asq}0RεT~L{GQfsB9?W:.t܌1U p;6TUTR\Y뭿/({Q\1FgCUL_)wc7LjLZmuQz߇Lvcuh#+5q?1:XD+N!G]k3~nS~ձz~ƮU?|!iPu'jRy2Čo z_|w*fn=UXkX/n_{n2uCw׆`s=uXO,'Vh;m<"QU`Ku2V?:t+;6*:f: q"zv SԺ~J{xo=Wy!_W1eBc;[o} /j|wYqUrQyzXNg8zyI:'ˠ,e߫DKgW/y z}ng?<)>YnX1?iy:/c~E;gVG=lP(sOecz%~1\uva0U0)eӵ;N7M;>v.a`|Ӟۛێo֟2?a Sx>~xw狤΋̾6{~f.̟e~ղpe4K黦49O69遏Y^-Ds&/ˢc漗HgFF2LVxu\Zrhోb2ďeN8vz!?+^;Ƥ.x,G?(ThcuM~]?{:d{#[4\c k| kҡ>䥵KU]r5KgL.e&W(+z5ekhcwuPߛ! yu1ϗAG]|=ƺ '+K1]*^n9<pNYԟwHVxz=^_p$<9 |v tpgx'_. ei0w[+>~>q|xzMJﳵY}K9_f#5N/㸌y[E-Zގhs-du1O:__! !6F92^2W[ɍ9%ƉHSѷuϕ:r7^*?}Ҽ^?|ח5+}yPcG6Xޯw6pE.^Nߤeg-*sq2Q^<5x@izXV6 }z_?mkwy2Cqxu4Ec{?-+FIOxO!pI\(C~_BcZFoaLu'q]`ZAF[B2Oi<+/_U~\|S^d(_*~z:ѾoC1u_d9E>x3ڭL`^ŇCz%h8AA8l6[SdK2eOw8KP+o{xFNtNѸ./m_Ple'+~x$|S?ޑ7+^qֈ_Wz'[R?ٓʊ޻ϠiEJٮűG_>Sz(]y' _Ymt gǝ2/!SvF,=Bz_2 OB9/n]樌yOzN5NG5?{#T3]c2qz0b"v*c>t}p[n2OXc]ߵ:HzPxʽ*F/O]܎cVY{t]N|y.PyfLox.eAy/XuMߡ83G%;XtD0SsÝ58n>׽I?fOً.泙e=ؙߤ>2OV~H:A9 MѸfsýK̍f}%oe}el/KibCl*;C85[)7<Kcs\Y\ATt:<Ennς)XDzmWsd:Odո|-Yl!{X(yFcv'} ~6CZ~J堌Qcv29٘tƔi}/{ld_r ?0npx.s7+g^c%>BZ|ΪuՏo6+CDJ)Q\,9Ԏq? 'j1=tg^ j|I(s[w|0>rIqah\r#J?+˽ !(&~ ēc=cl)*Z^Ư=ƪye-ʙvwVR^^0 zm$u,Iykv6kWu;\"mRgE1 mN6'yp+ k)Cfȁk%O2 c\`aέj.4$_>+80Ou+T-\K Oo {L`^V^&|>188>!ϷW|s9鼚{2^%^wwQƴ p<<lJ~AI7T/ ne+Ԗt z\8v!h#~ۓ$6@ `gey!엱L2 x~ޟ [$7jԷ90Q<ٍ>22ƕ2.dLG>?VWn䪝݉A=2Ɍ5xD>Cu}ů2;?{:k8)~l~>ҩ%3v<,R&Vl2wʽuɩȈOu/cEa.Zpˬ=?am9qH;.zǘlj(e\lܷaX7|1.Q7G 23<{K9MW.cڹ)^1/a:{7O_m;7mgV)g9Ys˦S`좏192/t%77xm&[cR3V30]Z?ʜI!ec৽̬cNceSVZϐyxbځ9|.ge#c Ew˧VY3uKAr36b`p-wZvPsSΙWԹUhc˗*kgeuNáͬoF?!=׎{<1Vʿ7I;Zl--e~t8L3-g92uOo Xt?g9=M/w^Ilmɘu#[%쟍Cnk༷-t,6Zy7O/ѓe e^foj.3yN9si:'\>m̼cmsVqS+6s}꨷l{؉+8Y\2Td|\f?oѽ_2q]8iY۝|@ ת]烦zfho)Sѹʰ<$)O\tǃ?}깄'ʐJ;-9~@i' gQDaХ:𽸾![HJ~U=乭M9Q+$p5 s<#=9 N$?yCWYX=y{UHgqO8]I9sp2")>޺\K[ҧ=ytE~6yCΟlTݫyN v\9~2kHƃg9lj7'>ӗg?z 1 ͬzsz+>r&*NW6syMgy Go7eK:9Zس챓F9!1כֿ/:0y{SF}=y:1-s^n3f6ZGgy;;mrl|9\O6] 7E?|v5' \L_E;}iR {tҾ\Kk.s;|ᙸ2q4Q2?is}[/}.Ϝd'|z,Ϙ}³F[/sY 6sf^3=M#.uIu kC<'AYdCٲ7?MuzfV0؞&Wپ6Ζ,t8O39:1g񾗍79iO& 8w#3W9zRY(_ gƿpM7|R6we?әՓ>ѣyi1+/媴}0㰣2wmciڸZs mOqܗ}ʍ'w xwٚ"ųxsrw=TBjc.='[\2:)chLB2iWbe F_.sj?Kȥ[Gߨ骁C4tӧJ}S.jd>9l9]@` x\_pNYSsR;(x~u2r\ ucqh@I35lyB=|I0~O=¹m_9vmI;qMg~2+#wLVhveߞ<@7/N'τA'.LS1Cӆz> ۹ZY,VwCƊy. {sʘ+;!fޞmwF}[?O?4q̢=+4ov[^$-<\[¥=/#ٸZ-q/9v֖N#cݎƔ;ew*Ip<]]\oycuwmK>]N(>ѯP&hWn`g^n7Z`5ЦZu3[P7`pv \Myqo[bts?5G ƶYLK̓v'dӜB.L{wuI ϱSgpzr}qwy[IAG=N-q(V9F52Sv+">Y㚖!C_J^^mf81;Ѡs;g'w§oE;ai\;eG ZS[ƿ[!IWȝ\ 'tuANw$]gOקc17(4e8͗+Ma 9t)/*$cQ_xDs:ʝSx;Sg֒{Թq=%;5 `s|ߢn1F.utכe+ΎL4} ׽= > d1挅s"'ߝNdw[rQƤaw8JOi՞Hom]&~O.Y ra=ekL3+ ެO6'f*qeRmt_V2Y>sle6n/8o`pi'qwrF1#& }?Xk" 0`>r9?aP~1|˟t_s,_'j5h)ܯSp=>ǽS?t]p`[%o+[^P;wpeee>*c2ΉN.K/z\q^];TF߰kM7枮 &Gh~]v˷9geͬ{GT ЧZy:qRoS~e#=)㿯.J=#47uޥh/U7&\w'5ߋ땎E)#\OfG}kݶe\d1"[hGn?Je15xyҾc~ǐ3'o{sZHi?ıޖޗtN#>ꌿ/q/Sm2]3+Up'諾Q+g ߡw#WeaN>J땀{geo[I }e{=ǻU}3 qo iXZw 4I~I{2k *XC Ӹ?>AnV1 ONN]0')}<.c R|A:੾OPEvs*W|R SK?phڳSlzx6{F' | T%^#yu G)␟Ș8^42>oB3oxx w2xns9}l겘(Ƅ6+ý-m9+w>NzkѼڒOgϫ]ƊϞNd\/\v?+rܳ2>DignGN;.xl\ ⭼nv%eb*gV7k.p<?~I_itCÙ%29Vf>|{gm[yZ^p =rwg7gTܽ]6߸~8.cCoS˞jqdj*ZϭGll+܎ֆ;%ρѦt}2v>e}86Wg;=KO1MFY6~dpj\hgSC;=}dT{n}Y~O(~ğߥzlb&c#h3Q'\g91>偘7S6/㿣9/ccl7Q=swS"^gyQ$.po].TV8%=e uIkö |'+&rg;,iB9dkݨFus?8=Z1NJC4d[|znkLŭշV-_nA>Lֺ߂9ɜk,9u]g'/ځ=K)gKݶh=Gh_y9!#|E֑?3 LZ{߸\<9Z;vilF~>i )[۳>\jeeeVZ<@{3m]XۮXCNh8{9Qvh˸kf=sY'~Q"r_1?11\ .2ڋo_Ju{-M/>>ONz@}`CkEz.}{{nS6oi}Z+i&e8c/ڭ+u3s-c\Ɋ4/ c@_IPdk _s>q8O]6~>1^o/pl+X=}PeOdL/\S(;c7yQke8?)4 1FwVzqmW̹My)>1\d}9+!~%3Y|>ۺ.Sgs %߯XS}" svM~goܿl5d;^~c57xsϯj&S7޹pH߻χ V67n۷fϹU\,_t2L/;S.87cL$e|9^埕>qn\j)K볲v?\/zfjӎ=ç.c 88{7ƶ-2G`maQ\:0qbbY,O ax]c}{I\sp :cj;39V2_9{Y:Ù[G浵w涤Rk_Op \}~m[=ű/}$w]:Gzy/#X/?A]?t՘tքr[h>*i,mNqv_{([?Du09s&ܶ2[]F/;{ѝFi9N|>V\~Hz\Zrh,wƣ׌moܕ#-sq!(- K}m[eyh?(}eɒuAZ5`! wz;{']!_Qd<|tڤ^eߞ}>oxrr/'}e?;1v.˳qY|8Op<崲CvhC v]2~<]7|9c!^QȞLEKW[zv <0>43lAQC+ Cb<ʟ>9d͝|y[:-:2}&?R܃і~(03<^t2c_LyaN4e1 -wVGؾWQV<[|!pO9vm3owXni-u6٫qS߳}ꃮM]-C>찌e }F[.{Yκg&sJPDlZ5-J펁 >(ѡu!QD;Yy4_(f ~_Ƽ6`"xIθ1VK5{}Ǣ ytp!yv6̹:u맯Oaswȏ'+W9g8w/L|0+l#>g1 m8g#7-ڻ̟1~rN8_M`:]+Lw2?MSEZ2s]E(>g:cK-Uע~3XcgNRoD_ߖp^Ml~ uϒTO]yڄQph{M;u:Q(,7Ò8?PǯGh˿!8<-Ƴ<=OC16VZwfVu972Aژv~&d[shNZcѹ>a{2M[wecoQ&hh;G+Y{)lK6]~"L?$ŷd2wz/v$mĘ{Ge'Y2^x^DKl@:}lb,g?AYy|)7ך)5',tw{gZk|U|ٮt5+k)]egZ|'};ݗ9w~y![x[mfk*^/Z2lOE:Z˛y\}^3[l*_pq=nCؽ82 /1:o'r7>.y5N sC˟(Њ y&CC ׉.'|%@v]Ձ߾o߫wK-u[mK$ I`[%ckdy xb;3$3)T\f 8S,)`*aJy߲L_{80V9iGw8'PD.Q+_!tUE<_QIq=2.~M 16xSjw ?Q>.?RwzoTiamo{Gui_PUL=Ei>g&kT!~Sʌ*`mFCAZ㥍7PA*@JA^SԬ;Nk~|U0N?MHq8ZQw88杣{W7}ƀ)B-w].3;xĿs:_耓H ijPw[>xU{VS=T{;5iN}d$/{am CN@.\[8f^݋cn7ύcϫ6X^#σ|hor8%\6gDaWcxA>fտ/aXWTpLƀqUځ6 ןoU񶑿 [r_FR7\Ki`Y.K`5^Fp6[xm_ 30_;_EAVU c82Ty.YMvw?\ݨV={Q:6OU4(h(F{'=A67߅bswmsZWZW|X xh#޲QBWWcGKn ^9ۃ4I;TP47*'hh 옴AX{lTVԭSgTh,fMսk? v1E ðt0n0<h v\Afj_6@G'`ƺGWz|?Ue7i?XαS/x]6my6b ;` uabxN~h#TGuOx(Fi0O;}nTb6 d!cfh9(a~9)&x{=hh:/g XFJU)S7`~0PsGQiBǠK\V6hg(ݣg\O4R-8>]TǃNc56* 0yA> ?-ZfW i)Fm`S绺abz $}X/wioTi9xN~A4:ǀ>Wwm!\l#oPYv@0Mv )3(1qXCu*By;[|]c48cuoXitk@Xpf.`~%%/ri)o$ 5\xU߫k(m귺nXMc^hdA'WmEKÈrp :UE[9<~0Ġ9; q&u#恪=i?}t+mRi+`Ξ-A=HQ:ׇ<8iW-X1OVF>ʃ?p졪JA|zA͇4^ ;`ђ@` ?'\W37km)}:3J~pNR|_0z!Xi5+ %G_<)x9m;1> v88$ddx$$>b)]b8y|yϐIFYEm":x]Z*m2చraWJJߔ<t kUKOc ;R҂O V.hIaTip [K(eV>wlÃBG P eLt,X-t]K9 JM%.@SJ)M(V)’)0-CȤI PJ/UBhXЎcjo+M,m+(9gv5TRIzXi*%wYZrNXxq_HƗ$JPJ_Qf}lT F~&<FUWW81$gb(w{2uvșxҎjNyi[)m6UoHETsh),c2v,挎ʋ&|T !b9!>z*8W)Lx*j v0 ]x!fA5ObE[J]oj+=~>Y鱁V !}(!9*K͆5] "WZ.{nїRگʙb;.W9(aGu. FaV^b+ $-@D?%*hXHHȝC``)4THYxH*  Ddd:.")QqǠȉ7U"hITrT٘Ȩb"s j8$B?h@("52PqPZ!',\XyBQ_̠S%g2$e[rS%OϐqSbXj>'ϒI*RBТ[\ ^ J}}<)TY[@)<;j(LY:,M)V7pdJ"ל:-?dFIR(bˁ xUrc(5URǀ"k/O#k/!J:fݸxA#FvVj}xG*x?3+a%UzKp,~RcmҦԃE;=@3r% G:,RFbf}u|u:g;yj-Bչz(XΈbc}QV= IyK/SGcEBDŽB6|a'V0X,HکK,UWB?5,UH(G7@XjDzC (=iƢXObvʊiey"+p^SF[cQ;b<2 K qD Sԅ HV'qQߧ9-<MhyX`])zqR'x}8dEX{aTjPZ>U3h%uIC}_X2QUt$ִm`'R_`_vQ rʝ_xfr%TJF"j,aT<*5> k&|Mz\H51) jʚ SDMtd6+'SH(>B%[Awr zqIr<1A%O Z,<~p.^+.mҳ5W+ik;e[u;3vl5: r1W5W!_@Y[[M (l rFt5 O=FC9x aJ*nαg+h'K#K[,|~H4.3@%J:hއ*Gkxn;?GXPx4~@ wXR}B=c, V\ɑݲB8z:Tp``ˇWX7 "}v.m]m9ª;<9^)v6%P[1avw[=eI`ۨԑey=J}C5ϱM!Q"WZ3 xbgAATZBDj(ckr\[/wۃjQ(jT2Ζ7ZRa|er%Hg3 R`F3D`B'xmCH):d0/#{3\Hj6z6uQFô.:„|QP3:_p w]R)ށ()ɖ7R5Z"VW{&J-FW`;Hߙh$?FgDON5{߇%N.08}oSVFlq^~ǰ>->2A"ȣ s]ւt66umk[k^ڹÝW>vq飯=z]G9qώ蹫/;^}췏oc?:qu^څkw^މr'{7O}'?}{CzÇo̍go~|KtK3wfow;ԝ_kww}soZ{o=poyGO=k }ч=//wG#_z䛏|<ңw<=vw=k{ѳ;?:'g?g_:ӳ=yO'>9[>rGo޵n{m jPFg5ξ"5H*_c԰Vǻ^/O/?{h$k[ӈ,р̰{!v{@>C3Gst'#,yls8x;LxS?M쉿֊kjRJ+<@!!<{Y_ow97;K%>]a>+q}o '9K'}d\$g7yqZf]2*_g9ocE&c5 3xygoxb]}hL[_n}Uowz|˦stgkGj6SΟ쩯{7/NL/XYZl'w{2YL0&o| *.!$w/}6ʲZsOO /D/~Ew/S{#*zC d,tC܇juKj;zaӖ =[hm=lG{1|z-~${'M3?|nz8#toyƍƣ>Eft?G}?H!_"$&Fc־֑M{ZFL6mQإ ]ڍ^}y)SHmum= s{w'K{_>;:Sы{J=,SECMZ(etҜޛqҎ-tyON=zE c׵Hmt=$azɧ{ذC6{|I6Ծ۬GGcCϳQSɹ]jl-2M6ڴM|!~c{e!+qӻ{KڸEёFQT }/.9{dﹽ_9Km0ka e2a^0B7'Ԋnauר9l5`jd3j+GouCR#3̒[}7H/`56Y20EkI:dM&Iciw' 'w3zn6/}!O&'WwL 5ҒWgZӭWfҩevMۆnVϒIcuj|L?%'3 Yv5cg6ۮN$zxa&6f+ۨ]caQ;Ki,dk:^<233GVf7{1ퟫv~uvi::*!<+틫WVFטf5ƶʀ_OY:<ԩכ{7بf}+ҥU=:2Zh=-}OL{ƪVyo8]͚5ArJd%k4iMdbnIX!q1PV}_ [-Q-iwft冀b=1Q62\5|/ecm0.ad5zӫ˦amjV_֩N\9B/-+ye#'":H3L>p /36zYZmNN{r3d35'q]Mv>=`%vc:Ac}ЊE?щ]c{i5r<] ɚ0{K+'75Q}St7kдjT~s[׏٩?74=Ͱ}uXdw4; fdINN' 1،~Jh=`d@L$MK:ی-{NG/n?w4_ܛEg=O^Fƣt6fYa55r( a28z+n; !,x=w1Rmӫhiu6Rm_13ZA6Loi''Z)w{eR;\a,- 9DW򌁵0X;Wze/e8\)g2H?6[ݨ9M|m֚uײ&=5@bkv;Pj^0xvHDA{y~awA]yw4'eeyRh.-5ҖuAEװIA7zk0zF:nֳmϥ[1k55&f`zP#qm߼-Ȏc(k]_h{%/+9\5֏cg0%WgvjN[g'F ~kxj(#y/_Q;2bD։#hu9Ncv Fɳ㲲=O1r,TiX'gH8.wocK!xIف0} -Vz-Z vOO X9|_У,3rkza۞3^ʃ쟱VpJuO0^*CAN<4pUiLZ<;6.QR@ѻ] [;5HVݿNil0M+c3nraq5Nmʽ=1YC-lm~ɷ\b.\Z|9:fzSf6L6W.IiXeWTB<ޕP6of tYU19~vԘ톿J#jh~i7,Fmn" fi3{g~f;ztŽ񠾉[#=60I{!g9J F2M@gGە-j;mQC\j6m&Lj?1[gCpqK(˽ɑqndw0qL헼B`ϒKWْ0XvqkSVMCC^]ӼQi.-9'Z{d6Lkfh&z{O۾qkL5'Mcx*ki͑_.8؈ I\rPBH8WkW0Tޓ^rs61XCԹ { 'V𲙤\ndNi{Djqev趞ivG}hl֖1Ʈi{O~´OǮ,cg]Jl oA (=t汖2O:2}J {Z˨ueNҭAxQdR6ʿ^kd^wzV[ssj^ŵ9 +wPRM,Ѩ5ǵ܊Ⱥ1M 44Ô 38҃qybk,9ij#G>^c.Ӂ7mZIdWNꚳ~yɨM{ am;a9l'FƆ_3{WXH3.ױ]Ny%;8?in`66YrnǻRX·k3O'4K&ՙẻX<-lA2Ihm5a߼j( Q%JoMdfZDCe~csَyO_?积[Opeʩ3FCT6/?YZcZsy&6IesKRı+*zm5anM ËG) {p&5fi9=bIoltZ4 l?Cݴ4MjM\7E;65mx[7zf8Zy\F`lۛ|yߞn03zܖw٬/yz74rkiSFyFC.E^ w²y &vx!sr7[-kc޷1_-z,#jQ&F.3%[cܹl-1ۇ-լ)Zk;w~d*2{mt-btL Ufёk1N' P6;8̽>o!o~Z^{,y;ᮘM^r㺷GK5`3Zy /2_c N߽m{fgl3/~э40?gñ6u8,4ꗙ=KSÙho^ g)q4IFc''26Tm"r$HަM`S̔O*?,Ly uS&V'fpOk ;~/d:)q0z}ThD.\zjVEU(禔ƄsV @53w#!kWzP*El Q>ay@LƩGa%;X ETэAiNjf,`H3Ǣ~>>YMpt١bi^bf͕O(5G^=}&ڰeK>}~򧥦6N)cY~&~zGN @Ǩa09d7t *^>tCI?H3+t6OW/L5kf4| 0\r1|U9*wb.?aOjۡ]3|YyrW$.8}_pF( K72^[q4L2`{mJhFLs^,bpwPN~ hS>Tel 8cg?lj~k#3\QPN<(pd>Ⱚ97zѴPFj0R2s>olvpgG9}N]z/`mޑdJrrx íaw*sls 'ý|2&V{gTfm9Uo;`CmB@6`@0M3k4J?8pv6z^$ [9e^3&'a"$2U8Qoki削}0ſu&d&xb3a\K,g7q>W'p`?rWVVz +)?{i&]]TfGjXPA_8jݾ3\ 1|ELS #ywqS ޙ*3ϲӥʏaoG;"ƈ9.xw6*REoYYLjaTJ#]\O-mJ:MZxY%`G PEj&h%!+&R5θw%NP\iFIԱ8Shf4y~!'-9K}߲Ƀ,Q {8Z߳^Xg9|-хx¡d rkS̼aEF}^`ҕZۋW4:I_pʯU D ݨǍLeƺM*c /ȨN%{5z@hp*EÄu2Rtl/)9tӬȹB/35b:Q:| |eSYvd7Kok6ߚDC.4-?چ% U'@e:g+$Rtj JPwb&ԩ#ztrGp77EȽ:ш&8  0B|6Cmu$7>_q*2t;{yx]>oX_L".3auq6g.&Q;oVCRjmߊ;HMSF.dk͔]WoUP^4{ڰW~姙>TDvSv3=`.R}>&?]\_+1[;>W fsNǎzZJi䚖s@q,ΨIgqrG~ݡ>d],ct|RoƉ/XeKJu|f92:G,rS9:I%yn^m~7wZ%AldqVP̜tKY`U=G vΫ5ݑJ\ mi/Β\ }Qda VSvwbAwEPXre'zW|5F?cQb(1+;hfljsH4\A`;o͡k 6 O`lO5eۇ,UcK/e=:Y*D5XRmoSXʍ |o__dxj?َpu d^4̃`)qϷJ5?6%:Esp_ڥ]rBvFڊ+e0>DίT*+G**'+%e} (ۤ; joՕ3 G$a:-<<9Jdke=tjM_9Z~xmDa6h͠Ioط%oG9` wsEJ/+k`~z=(#>Pl|oVz|W?XA@ Y#xv>@=G:Ɗc!/PIzt.#PCLWCaΔd8qXUq2a4(ADKC2?y$sIp(k?IfeSf\$-l/cV n3mіMє*fD8Aqw{IΛ[ę> \'C @gc6^IaBIe}go!Sfv|X,K`7#ѽ rF#j3IM߀^`iUr-i )m[jHQr]Fϕ(}h$mokKj,:)Ws wVvI.=G:݆]vK>#Ǒ RbL:NU~J'jb7y "¸S% S)CTOUwJ" WxSrgx@M#NhF8BM(ѿ偊/#@M;C-S $$ү~Xj[U<[&'ݽA+5|zc-gAVS:}j}. yN88_Yx(P50=N#{ ZRelW\Epe=.Xvi]Rl^=pA94 䧏oӐg AԆ!$r|ƻ^1,,oycjv-?Bmi}3$QvBpoj,˝Ct#=ORl!= U$ތ"yR]Y@F?Řei'GNb_8~{jbγbJ"!Tfh)ףs]rbe_Si>GE)g;uFaxM#N=񨲤,RіjN.4GSZ?T c*zyu.B(m<SE0uL8pT.ITΊ*$y$3lkt 1iU3 .uHq%QovjIj4$RvFg 1 S-xD'Vܲx"?FaJbԔ"B-tVf+knk\X ~pOڽAJϊ#^=e]WyCQӛWe 3Zq|5i'rVomޓS̏U|&oV @YΝ>;]]z.e0L`D{7:zl#9n\X̲KEr aĆ [J{xV5ҍx˒e8:9:pjjvS'?o{>[mz@ۃ<itܚRh5EEN;ݲsjc ShcTK&$*Sk sPZOH$绲{ O?U `›ǰ:)SN{0ۜ-}ól9a,M?4g(aUlǐ="#iO~43}6[f[QTcJ\Okײv@ÀJud.2YZ5¸5bu[7b",H|H;mF#Lòޯ̗m,|y2}d[r75[E?Q嗼8_34O^~^LsZn0l: r뙼֋ftfD. f+jxW^[Jcd k[xp:58_:ןΠ%;[[ID+'80s&yUq@<ߏ\*e/N&ټa2mnj+PzNs,xUWAFt{PՖFzv! a3y!yNC/י.Lj$8W0Z>@փ;<*O%/%f)0sImx I[GקNzV \KEi(K TՈ͜]"&yvS92ʣupϙIY<=++U2Wj Q$^-3motU~ph6쎠z{)\]cEc1ɳWkom"vg=aIDZu!tR75C7~4ҫRKJwVl)gs@.&Q=H![)iZ dܳ &EP/-"D)HZ[.ѽ4 fH뗽~:pkL#/ хKk9l 6_uj;V]!di6JQ-UTْ;9b=$Gf#̻"'\ _+aj3F.}SaPyGsCX#뎁pE&l <7#(YJbSV(;1áUvꮿDl+'1gn‘n wiGy@PҥŽf=/Ikg@LEHx,k[2Ig:rY,Xi"NS˚]D33EnbyYʭ'J>^}]Ř~oH8޳UaiJ\3]d 9 ]P$RV`3l_Ke|}kdIu^{o3Vz?ٙ}, .e^2F06Mr¶#l" ,$$?qU5=Ꞿ7/ѰŲ(5gdŶjך M~Nكc/(m KR54]MOs/{f{)z} `Ϋ}DI_c:g  v ^ygBv)8>:_;75aK߸|]Clut֧{}7y3 8-*.'UzDwjf:DA&Т BFni/>q3ъQ[1WTn;;䝭zZ x)^OÙ%:\VOT@N4 .IϟLg/F=5bЮNlIA97nt6͆zcP{A?}X }۝mI$߈`܃I[!\z` ?s.DPecr=RQ*ݯR(C__̵y w2Cz)nItexdjE5@8.7dw`|tfDۑ%*5Hf}0_Y֫Rٞb4*&sY򡤜}bAR:3, NC{*A-^a%~ -\pw>iNilGLƝfrkp.7KZA cB˨EKG/uqG#]rvYbEx0;}/9ohvD8 ~=Zh=u`CV 1qNWV>?S(bcY0J+J(q,.aaFݵif$ uq?^ MMt5V`rUwnaيf,<0V~yJdKW{_+]w~1VurO#"UD>w`*("Â^}z!ǁ8C\(F14:A.-#\D:;kr!#4D_E IT{O\s956{'tx ^ ͎.su\bUs'|FPBO=㮑15dZ @y,xpi_e~Zzwh?' X톎k/ve=K -sg]Xx,̄ [廅Ml;yMɂ=uk9\xǝ|)t65+-Mf|N*{ EQ oQazꝾQbE Ut 2|($)iUAeeMk8*bqc!^4!/6}z!JiCfb:kk3 l@azk,Q^=e1(F}n|'j9}A֦rװٖ& W=ӎ/#bSa~ 2ż ,g#$d(ws5n(p3QA2[M![XW c.sjsYǻ9+lBYWwMB؍adaT)| OfTFDG::ÈFzh^zR|zyл$\Z/8tO\]ä-1W}T w99 oYx8kQ 36V+||?l4ܺx:Yd]UYOT&]b.Lm(;j}3YGyѺ&أ fnB a R0r7ߍ}bl es%BA#PȪ%KN66Ǒ+,6 ªשÙ}`)f3"2,Ȭ6lIy!ЫOF+}Ω#uGSx@y=i3).nll 7 RPM ӡ.U "G<$3sϙp'H'N1>䎇J=ZkhX`*ΰj?Q-uƙOd 0źEmc8a:M"PPaψޣ$6gqdہ"xGAwRigv5.5E:P&=AiPFsz_ 41mԝ`RPi8xI[`A= u֥מH~V6Zpy_F?s܉'b+ohDaT{{$@w32oμج#C;ScAysϹU [L.&}IjOx~c3h,i =8k7ij_YjN IQѩU'94jLD[#'(Q>;KVc8>fj* ]x Vŕ6ʼ &u&-66yY؛ 0DAA!U7N8*g>~rhp{"`eˠC/{6MawBz 8>ttZNiH{.?S.jsrQiHfN~e0Sqf[3hWa"9Pu6L_uP,HȻVJgwSF}Dh͎pZg>WԔ*'g:GSHeJ {LRS-h`-g:Ԭ%?_G#ӥҍw !wBOAqɘ=5TC.3o/rd䬒U'px5VsWuFQv &=5q2OP@[3Yp|=E)'OI IWʋ>&]=+2h2:*ުKph=`7LPk%NuMӰtTNMS)ب,6E)>v2vwn-4 5d~ f?CHH֬.Zps3?E!qUgۊ8XFFc]ZQ )zC \2N,O`vXX){{Xt0Dчzﯤv7~oy[n5A{@.3KRx}̑;g3ռۢİ |%<(zr\}.9[&r2<:1qn8S8fSRXe,ݾ L;a~Ǫ@><!S$}2}70U.d!7V=D5ȦF-$"ISQCYMaqq}n]ddX,x˾FQ8W A2ٟ#Hc-J Jv1-m8[e2׶У/ݴI\cUU}w 1E*CY~jۋ]߂.(ՏoXZ<_u$!foH[e㍲rBFT9Eg3q:ur_zIZV7Ʀ@ܵK$O/QPY:EaP-bOAä-ƨDx'2='gysOy90o>c(ذSr7au\OE/SU>4lx$vD\RFPo@FUU%iO1-VV ROJJƎ)T1E@~li.zO6_2y7Uxy= qղ`K #sYoyy4 y3ٹiWJ}ڲ;N&&8[6J($!JiHSJ!!gR(7;^ɒ,:vj4o{ޛ'~;NqBtst{Wn,IDl(eʍ\AbRl$6颃T}S CI?^͵d5!UP bںzz{\`L=jdx%..ЇrE#k X%+;Mͬa+ktѦpuԆa5p=Wz{.[J&.zYb?&f-E7W|ll;lUJq|cӪfsu_+z YQکv-y耒lgi 7NKѸ,gTSζDz*@uijRk%lL&պSltI=F>ͬzU\,\h"Qq'+t%'Tް%GӒ +y<%F>@n/#{ Sڳ67nȰ7ES4u.UD(ȵb'4I4l^EC^#.]vͩRΕXmj%"X`-CRVU#(a y+R ~EۗOiTS~sUc'+aЭm}쥋Uou7nܡ_B"Ѥ"sT^k!O]˥LW$a]ÚCpm soZ QbbڛX(ʩ>zJZg\~WoZF]lf..DQGqkX_YG~67::B8$mm^.oo3.oUY2…=@D*U+XH ꮎ_ǯt$hZ_XPt4^h5qJ,7w!P^(_f^H~d2J*H6ȺTXS "ҭ2k"T0@!ZɺHXn'Zn0DPC_0|YzA- Cޢo,9"ZZu .g^#ëh]pvKOV=G5hγzDHCDzD$.ڝmPMirDr&ut@~:,ٚeBk9SŪ(隚1PhgcxQӉ*G;B$[o8!%82ç-HꡬBdحAdd=DP=rDh*x3v6DNrXSX$%bۛH{ݡ"*. e.LL(~w-,;V,D}ɈUkPHd"UM.h*`J Վ|y.v #z^Pt۱Wگ~~˿кiF(ؑ[NͷJڵQ]Â%WGIE$mKiN̠ZɒIV*ZYmҰ5(P"RjȤp5SuB(օt{4tg/,>Z îw6(p"5/K[MǯmzVO7A$CM/[}J2t;B.U% XJR,ќosFN1+m`JXaͰ.r^]oxRХj3ҋNs/4]bΎk+cYmz3vfmrA8VZh()UnoEp4㴁Qڻi'Zv1-BW*J\d$$& Po (+B:yfӚuc$zi.3ݙ-55Ö=ce(蝴EnЭ:2?mLu~ECPa8e&Ih;YAdRZ$uņeHkI8O&F(ه**+M ݡc@u5e$Cy\(DrTNs4[&LNz`(=-G^_M}ob" ئptCM\ 6UKkQItk,CV1b=fJonW5Fh eMK}LY4EږjЃ3r}:'7+FҌalr뼫]q 5&@}ְ5@wֱ8Y $\C@o{U_V2@ތW2=; "oǂ\juYc.xGќ9tL7kǒW6,?Zg4ƅJj -n]Pd .Ӝ+ўL/-9ĶI [9TU0םw~Y"-g[i3ɱ4s84Ό;iΉ'UEO {qSn}p= {yDnk:C;]+Ln(Kjoo``PUzF:+t圗W$_cbt bX{]9Ũe>Z-|2## la1cnAy.@ϱ?rE'Q}FH8K :dz$7JJ|*= ?TFj7*)y9t7ΒbZD5ז[trZüw6;#nLJ:\k_ vo%(Zm*tNft|S1Sj[Z}Zf~q\7/iퟣO&oM~Ѥ= >{. =[Ql\#P|MGQ/36$|fzm]Q~Eֶ-eQ-U/DQt*ΖePTlqΙ/Ό]7 gWfϞ9B̾ed=ΕKQ|E>EiR~`9/j:Y5.Q߂Åu(: >(=ɺJ<IEѩ{o]mcQ|؋BisyvO٧Pt@tw(3yg{q :oȗJK؁(Zކ2((369`3wp7o?(((((((((((((N 1ɑWn0fi񧹢|tјnZ(/2JX29Ooi1񧹢|tɟ$O`tZa ӄta0狦 hl/%f9?-MF?Ysȩ=ٱ~uWn\tp񣇇m?1mwuw=Pңwu@uc@sf}a>d5as9c0{0o{bs%nf>; oKN`tFy 낛['zvnk_{랶=[_spvuOnu쁩.X ett1] |z0s$C S}~xz'`.S{7=dLg`W{7^.te2wytċ!q3ԵoеѵBKʇ"D>G{ċ x[>o{]{GCX ozs䖠KnkpC3> ,>mYQ1Z k?;\E$xtœ뽘]nosMx/'̓Vilw$M!q/GN|,|#z6>gƾ1Φci0v*wR>ӿot8H;Y&Ɛӧi: s~|GKӄF>J3aoCAt#zdx"Lp'ui <\A 1${V Su;Xq0La9u*7vW?LsEq:uʳΙb`h><y E-o 2[yXOhȼ[qZQבJC|̢4vn8gK<+ul&9g_0ߘ!唎BXóq>?N|Dg>*Ǽ\2ҐFAA|ߗC[2Ѻg,Tׂ 3vӽrkkZ`^AAJRjS5-Xm1&U~k)Qs@A`k2|v\(2}`?d:6H1Ad69W.RkYfDe{" ^)fk 11{!r^f3( qx AJ̫y cqb1DAfD9,eVg J,5_ӡۻ!̃ca  eAd!R Sa:!g56a@>D/Ķ V_ϗAA=@?O H0=Fd`.J_W BF;I 3B)  M7oZMncod6)2V۰! Isdn6,   R}bd2ux!2@0  01Dĺf8gcm A`j.ʹ | C\)Lfw*طAJ3BAA 8Cy26_ X^?9X5  sɒsAd6AAAAAaI~?C_/NpWj^5              0mL'CHtޚ3YnO{}xxQ%eeֻ!{{{=L"$Jb$twGcqDݛܛ#׻6;wrǽ׽Ͻ}>rrsoqou{}~v7ovoqtrgi&!, ʐ//gsy&6yD||L~H~L~JbkFma{=̞dobofb~:,=g#b\Kp\W˽j] endstream endobj 241 0 obj [ 0[ 1000] 4[ 500] ] endobj 242 0 obj [ 226] endobj 243 0 obj <> stream x @U}~&M~IGD¸` 0 8A7j,ivf8Yee7k+-+.[mW-k&yA ۯ}߷s;<HLUsmHUVRZbc]O̟}}sĢ9e>gT-~N׿3^"󎃘qEՅwC_p6|oyZ\8w\J?)` uCX1Z׭ -t4}{E?̛5[ #|)8d W;=Bko3'o}s mwV3.nJ q=o~:`x V`UciVDOuC<]8YXAJ8N} ,%N|EsOZ:ObcIjղ0RvMOv˺iL}s`Rwņ膶ysw|/;R`zZF]0=m0kW7}Ip93!|L!_ ./8Do0-`Z!ۄoT{pU+ /Dx-b?ysgi?3 O$골D}i}O>j@u}7OP7&cG!²$4 p& e:B-;PHR фӴȴ$dl!h3`^ Y@AH:<]BBFrɯцTtU,-^\kw ¥u;qvM 1_y3TҪk֭i%u.Vx9ʀ&u˽~ח u[|~0G}4, ~nf/of|Kӏ_sb9v @ߕ3(p?<2M0@=\{ | !_WY H }wgc|\DUɖP\ж+zhƈaQH8CY]-};n7x/a|.X6f.7p\ Wojzx#l>V߂r5e=mp'܍vwa{Z~l6leVmJvB]xfTz`/<@|^a}o`c|;H3~OS>k/}7 `Quh˷(pb@ĐЇg?@ AV*A-hA0 f!JGCz=?1O[aB8K ?GV>+oL 0BfF|NUZ}"shͩ3-4űsgj750;olܔBG^=sb_#-b3cGZFcɲFL7x8a|%+Jm'N!+Np Ie'F2UU ىt:)#ݜ=N\`V4Z5bu4jDڨ$2mc_BUz|є#5FQݘ0r*fuTjb.60q⺔D!1;eD6}b9tLc7^g?kmFsQQba#69d2`0rd1!a :+":jY)1f Z53qvfbK¾{,8R\\X%(8`(X1AƘV=hI*.(+(#NZ4b{q☻%EIHR Y挼;SG%Gb fccT8^&F[$:2: G },=?G-DИ:!ЁBc3 ,7Nh1Z?Gk'j㱶@=w?H>׷x ֦ zxbr$ħ쉘$=oHKseלrs]+VTB=6q9 qySƎ(g*!8oɢ kxŠӦ ;Fc1_Z1vs䳪&岿0=6zHzƁ3'G %ڐa(4Hfɀ(,06-^Nt<71n <¢ =DP6pp$wF|H3tq njaO3R2щˌɓG$Z%J#)N;rzhZtv*-iSh5A {`2$>`Tg.)3> (/Kv`HE%SƄf9sb^$l'M4 wCd7ka&gEGgM=כuR#QF5Ss/Ƶ^J-~' Y)x})@ R}xKJjVYcK(So඄|!"k",TR"D$"HD"D$"HD"D$"wח3W7 )0F̂65\Q"/R*HYYbeS=Vс1,m觕G̭[7`lF7 ;mZ;Ʌqq6u>^c;Ōfە}xlZ'G^u+Os=q+'?0hN~:4#;k}wCk\x^] ?%#lmmnĕ8S?ا %׊ޖ*E_$ۏhⷓiuuqr6-hG{'OѢryЦǺwZʟYX^o*j7zX,+y$5Ξ`~u|tsgF|pSms86h=KCT礃ȟSKufۈ'1lwM=ٴ]s+|9yΞf(vR64tUOI7||ݍ9?{3t]DBoO[;8;Ŕ.%]QolgfʟtB3QWÞn`g;⢱-׵'vy.jʳZ[%-}^yu6Yg;Z[<-rWvm&]:ڽ2W:ZZ-fo:eҾ+lÑMrx\=Nq:Z-m\AÍe6kqvӃ^;n ͖[[]r3.\nis;}rKcrZVq4-VY(h_'7qn_3=܋mͦA۲}.Z%\,̍.~jxNڴC'X'MPǰAyM6g5 [s\QwF7:yrSq|>{jaaGG-<Ί慾un*ݼѷ*ҁӯfvu.?g:qr\xNO[le^I5L:[E7p(Ʈn Xܞ4hD+g*vζ6褫)W٥<-tsgg&k_@n ΂=vś\.IqZ)^.Ƙ>߇a_d6V'Q\;ßJ O h?C4hC!E7r:JטL5?l]?>:ScbjEO6 K6"fƪ'. ) l,h ZL!Cl-hkEhh1 =86mvZaBT-@)h~cb`h{Z,:v_t۞ᱮPz?Ԡ$%uԩ@˒Nt*^{%IЩnݪ :Pz&1QF}ԋ\pjkpQЛ{1}7Q?b]gkUVq ~G*`вL!}&/PŨz}[U Z͡(oFhѽ{'<ʣ׾pIO'?tS :tH2IwKwiL#zG~tClkOozz'Lf`6Hm'p4Zk^E|-V f{HEqWyaj׎?@^R"CQBk JM-۩E[QUU0rɢ2,ab?1aU`8HVjj00ay|_?t3LTԾu͖u})np=}z+ 8>u@Dt.T~py" 6`tt#TT7+5 v.2 3S8tid>K|ؼѼI|2J҉/E}:Vh^6N)Ϣ43@WSgQ#% e< &.W Q7rE ۸;Īb˯b/헣$qO!(3D_IxKߩ$.wixV WqybⱰ$'K"N)U\*,]Jq9/4ɣ$d{O%=']E:)lc|.i-~YV(>9(㳳'[c@ΞQr(w!JS^ jaW' &yA@,܋ԺrEc}Rƽ5‰(œLNj|"N~fj:JԵӞ>^.Hq"[NW8kf|rxZ۶Yl(Tv6Y#f7w<5gQ\&W.|q~ʯTr,,hZ͂oXM^Tf~欄ҼȳJåj!vΪ:Suh\咘%[Юxϒ:[~QZꙗyVP0jokלƷ55ygkh<ўO3o7ܻ}AEkW\{])5]:{vgYL=Ud RтP\PYpr~&I-H١ ;YZdBbi-Ғ0I`d޿LRA_ׇyYXwl<Ɨg1Yg̚5kެg=6kŅ  }Ec/:S/z{>o#4g93\9'=75wf.gIz생o*tK%`} ??[{v".P;4Әu䕇?ݸ8Bq];P9b~O-<[*Ӈ;];kzŮ\wez!X:=.O,}e:ևC[_*C@txz!o _`pC>z`VGuG7Nzq>(ucC]O<젇n흅q}>|M8; dw֘kՖ5֡g2r->XX Rύ)\))e]<;6`1󊟊_Q_S s*[Wmk57h\>RZ#S[cq}`př;Q?X[ȂTQ)?XpjԸGF޶֮|(2_n{9શǞŕhWaU\ъk㫸nu*'U\׶U>Tm'j/;Au^֯_UAw?_{\د kr/t֮,t g& §/\tDUa3xkڧS<[\|wDwS}CVD}jO\T܏m۷^L);)e=K>C;}{()n{Ok~ɅVaU|X<3*~: hWMvdZ7*Ν#<%ar)Daq?Y?Ee% KGES乡#lWpeOGq#*^|aG/|I}{DǕhBɩN%ߋvr<)yfhJVT::V˺+Uw}'5X<@q>Վ~m;%/ n/!ܛ|3|+p+NٶGvv,4ҫQ]hSN<:.@_¢B\٘Kq<\qUZ<-Ѹ%Xr,o;ShOJMN$O™Yɹ"$=yiSaQ=+qb%Z*u!{'*uaQٰe{y/ڵs ˾p6k@2ڔѦlhSht`cލ,;SI+E#.%Q ƽф7ȡT1Qt`e*Sny]U<_QeYl])~,ۦ˶duwQ|)y\@'o4ygOU2슎,Y2шmUqb4yO2sCc/c/oJ4|QrQ2dL̲H6O2(FXc7Ƅƙl98ӍsxɌXKnOz4^Иͬh7&C^Hv.9PnW:i ɵ*3[=a u~MtGtiFp.Wj\kr-+XX3VUD+VcmhzcCXVEa}cx{jzKْ%ŮINCtEȖhEkױasi;b#у^Ї~0-jvdX^~h\U#Ͱ;ޏtOaQI![^=~\G>_brW{Opq nmƿ_8nr񣎟yTΣr%l)<*Q9q=򮰪m#,6n9!v/ο3*N8_h~@5Va>=ӵ>͖嫓ˢݢgWdfZfefZfefZfefZfefZfݽNmiefYmieQVeL^eL-}m'dMZ֤eMZ֤eMZ֤eMZ֤eMZ֤eMZ֤9dy.\kiTSifofoffhy橘bi*.V쒨2kϬ'G&LZmv 黾U>}ާ/"jLY'Sɔu2eLY'Sɔu2eLY'Sirr]fשujvݤf7Mjvd=Sk5FͮQm&Ӎ4N7lh)83:uh:v)kgڙv)kgڙv)kgڙRkF-S{:5Nͭƥq)[k[6^:NZVouֿ:Fίk`)NM Y/Fm6_>u|Xx Ǫ2j+xkݵZ5-=uh\ى]ã2wlwYe2gAq\?rKF{4H/inqCy_tl\}%,]FEg3fnW~%;wY;vfIO.h;qgFcN$O,f6&3`flM0 f6d8D'EgLy2ɔ'SLy2ɔ'SLy2I<̓ q(×e|_op4c^r'q7C~CXx#xqO7x2S9-y,Ÿ1K^B ^bb?KLN'WK?ExKK,RaðQ1qaC#Ѡ![v/{!,o XxyH~|P^v.5ݱ>=}k/O3~l["6T$Qa(C9*P*T: +Fa4`,a<>a_a_+vǞ4ɾa?|wvP$w] Ƙ9{?V<9)l, bHHWrTV".(IȖ$J1 e(G*QjbQ2#0 1c1eNacb7=qO`^'&Sg0 a|8A8/Pٗe|_op4c0%to7L4Ÿ?ƥp90P܈p3n?3]9=}h/q?xVÒx#xqO7^ތ<^"Ђn][Eu+t鳭tցqd]{UWx:^Wx:^Wx:^#acx xO< dzf<DuK,6"/6l,NoewDUe<ͺqM,et̹̜͜tGCWc02~9O|̷񱨪|']]'0{3My|rTWW$Qa(C9*P*T: UUhXx|;<+̳<+̳bWݱ>}GGO9ǓBN]X8G9> xnZ8Nw;30~VWV}yVw=\_a2 ]%QUeM*#HTwWZ*87رBuR}ſXhXхLEUjt$#E_+GH(2vaQt\J\quq~qn-v܁N܅^)dj>2QL~' ?N|Ua}^EŝVW}qJX_5g,pE-[,Xlbb-[,Xlbb-[,Xlbb-[,Xlqa}8 G8SplX/UZ()-bg/ ĩ> -4h)B/B/{["LU#.%,* 9%9"-Q"<['Dh8}r,C ?.r/r/r/7*wn%.*Wx^>qkCvU;c ;cp*N. p&p6p.~p>̯G0js+fCX:7m?=qClܰ"q1.1/Xlz&~qn/^D) @%Pb8F`$>Fa4`,a<>r40Gs40G\AaE/|0| _WUNi8q9qG~ ЈYᥨT欧bri^x[MB̅xLjt[qM8Qإ0Vn+L M1cԏS?~L1cԏS?~L1cԏS?~L#HM)84 L|g8 gnLݘ1ucԍS7* lbNvjshLfqRZghIR91ǓsC2(e|Ẋ|I1oTAlPK+GyGyGyG<^˓WN.fbY.fbY.fbY.fbY.fbY.fbY.fbY.fbK9.帔RK9.帔RK9.帔RK9.帔RKY.eRKY.eRK\R':ɥN.urK\R':ɥN.urK\R':ɥN.uFRKb5΋긐B?9@wS?uO~Sy橛ny橛ny橛ny橛ny橛ny橛nyS:N?uOhoa@gЅߴW%ŵ1{Ƿv*n@Ũ7T܀Pqh=@Zzh=@Zzh=@Zz :mn3W*P ^ߠ7&' Ə6~mhG?Ə6~mhG?Ə6~mhG?F,R0K,RPC5tС:TCjPC5tС:TCj!á 2p(á 2p(á 2p(á 2p(á 2p(á 25Ǯt}mf^Y(4 ŘcVY1fŘcVY1fŘ.h ĘcADLVmzj{{yrzk핮hdMuS+9*}jݧ6 sS{w8=QOv#{dw|7)MnwSݔ|7)MnwSݔ|7)MnwSݔ|}=GȾ#zd_g8Ǚ>q3}Lg8Ǚ>q3}Lg8Ǚ>q3}+ZyRnE9:iڦÿk&W_D5};Ysf;`]tk'];IΪڐi隦ki隦ki隦ki隦ki隦ki隦ki9#zTS=rGNȩwҽt{';INwѽ]t{ݻE.wѽ]t{ݻE.wѽ]t{ݻUԸ;4k42Lny}ZbS:^s6''wmNh|ߢέ&n<žþExQęŎڋd4:Q.&=.|[HFޑ>z5![sZh􇚳S5AͅgΚ9Kֹ0~͸ͱ쩹M!_c᝚k)bYܟ|^8~mިǻT`gKWN-ٱ1zm*ZSGUT]EnjfdYJf.sTQ1G * z `;(Pp=Rp-R)k)C娗\rQ,GrTRYJe)TRYJe)TRZOQ*GѮaF0$BP3.+.NteDd2N;5b¾ɝɏ+d P9{&yH/yX8u/RkUULT|JW|ۛXڍ5bF˩ap{jT>;ӫ*Ӽ6׎FH!c֨vN/<'=6{rvzjވ>&z<-eR,zGŲwoE]KVtɊ.%#bˆX6Ȇ#eBL 2c]Va.m[{K;U\1~;|y6N&*{f~'Z  <Vg&dWQuEvDžVFS}|w_2x̷=.%6QbV%mH4VF|RHdeCRႤ55iMMZSK{<^h?߿7j.CPsT`F5:Sb>%櫻 7Q{7\M݌|wx.c( ּ,RkXף=\Zje(Ǯ>=W{nn#v? Ll]g_V[TE5ovGYghTI9ĞwFqb͈5b9l#J|22?Ki}ͪhtb^Cj__:b]"vloz .-Nd{7z|o/r.Г^ձ;t;Лo-LlTu (R6qYxTF.V\Uߖ 7'wD*&[u5pO툝n=-s{ LSeގ-<]e pm)ϹH~A884%'{ U䡎 i_fJNvJaYo53Š8'JKUpYr,9__s?ƕ Whtus6oƹ{;\s/CSxXSa*LUUSlM2p \`_խ7ቚ'[=3r{< [5/e`)XWݿʽƵ_Z ܩV&;]]99X#k25 5Fd!kzЋwװ= 8\Ϋw6V֖z\QsQ9X[Zkk1qvp~F#ΧB Q;xc3Q숏wgwc7tXڹa ?ht-ky]kp- jo :TjN5UX[M8?3ƼM>piq'q.b'{/**CP>j}SUR/T UuJO\bP1U5d*xV9qm>7,N֯7X/%F?[[U{롡5ioZ^CfHʘ f͛͛fN^ky={vh{@/xH/x,7م륚=-4[`/Y| 7W_}ޯ>ﷂTwGe׆uu{\w&QT?UR!iİ UQ"dY;.8T\`DPٔP f"*34lTB }o̝Sgy9t5,x:R+ jjjt$A-V^§Ljȟo,׉l1]d')QNokJ3Fe.; H20v@d$Iv@{owʜĹo2l^S.9d$9jN6»8'1o#FUVCZ|}YwX=$C bunu(q[!I5GS]jlSЇ}XGчutlrOolҗx?˔5gR+4F#OK*~UA*G]C5vwnM{iv6v~1Ā ׏R}/uXiCe72BZ}Vߠ7_ `_>pL4z=m0Mhy[E(YsZfTbX)Yс2ׁ*ZkZƳZS[YtQA$^2*_*Oʓ̨6ړccUXBB:cX:ƪO2.bV1X~-c̸=feb^KF7%ӻz]Ke==%X+`\Kp -c[uKn -a5ئ{TˆӉgB>ﮝkZfPHo$7R^jXC!7;2քw {wil$65(&`#q(Pd)Sh5F›][-,<$?/_qW_#~- qj 2Z+d1Tkh]yNcI}Ɉqw ;ɴܮîصwJ6:ZΝ:Zæuشm6m2{y_'Y1Cg|% ׄkOӧT+:@^|~a-uX~~dpIXZ~j@s5\h4Vy}ՀjOs94N{|(|>|%vCwݔ _5~{_kp ذVcjlb=u76܃a56Ɔ{lXnlJwcjlXE7VʱZ9J`M=,UEX$5X#5X#5X#%X+$B+$BBbx <g¿_OzF2F2q` \ ڸX" n;AGa*LO)sDGj6Hŵp*?!c8΀g08 Άs\#< ?~ ?/"ÿ/.a4jD6') 6 OW|c,y6`F VE,tnz@OثGj)S|s0*^$99O٢5`ȁ3<VZMjV^ YM+hCoQl]m w;&_mMv:t Ȅ(mbMLs'pwp|߄fO'Fхw&C0L`,lda# Y؈Tdqw8v,^[^[^[^[^c{="@D lHҡd@bT>k<5g/c/c/c/c/.rD T чq<.V<#z[IDM׫msd&KDTnY2_ewr*/ɪ+5"j$ LGa*LXsXsYsYs5w<|Hǿ_fFDoSkC6 V3S93|L^OP|G>#,,3YK`-}]?|rNc9\<+xbη?+47|^ cs 99:qU??v9]Y_}=z:0.gzy 7a8}o`.̃x< x^|X /+}e^a>tx 'I3ŵa6́gYx< yxA,%433Mt ]@-nc b-|Io!YośEf Mt ]PCtn @$P <_6/%D $QI@%D $QI@%D $QId.^2/+"w=0p_p?<GGFMGMGMGMGM7u:xSoMCܭ"VwU*nq[Eܭ"VwxlO>'_}O>'xxx"jj=:GgL3}tљ>:GgF5Z8 mp DDD\"Kd^@yGyd YB,!AT>BL!A$%FS>GѣdHJt"JQ$(d 2?J䏒Y$,扔= 9ן_K@BD3|(3E6YG0 %Hy$<d 2G吋rE9rM5惐 #GUPY%$\滰pc2\$')8\K.#  @\"5B81'/ |*TzG,@,nP֍pA~[x͞&}[:EPE;> A8>9o͡3}TC>O> rPA>JhJ!-|r '-|C-|==T{%\#=r}\#=r}\#=r}\#=r}\#P].Eu.墺\TrQ].Eu.墺\TrQ].˵sәpf꾍vswr pJ\Bsǹfߠ웪^뷠YyiBDi-xK**w k:5e7ιZxQzOw0KDQ|Q_EEQ|Q_EEQ|Q_EEQ|Q_EEQ|Q_EEQ|Q_EEQ|Q_EEQ|E*檋XU1oRrZnGRZwh}Dž-]J'2yYJjD]D>oQbK~])]@kE\1+f%2ˈճo;E_}I-z3ht#w8l#K\%JG%R?adfTU+aU"&X`C8d@&D;p0C3ŵa6́gY6j`@L4p 23'.p@ڒ&T<84U1:w\`;w~w0u,O?>O?>O?>O?>O?>O?>O?>O?>O?>OӊUG_}ѿ>G_}ѫZFЙ@hZtћiY*\\L)N1U2B7'=JƔ1q,"OnǢ$JW\/ Rq!}T9ؽ6Ω>1pIx;>C5^v-}S~}|6]HĹxPRkWGWUp59do[9diNZ8/|&2>MLrvѲh 8-C U {AB=n~rT@o>:]bXC#_}L)vSCF̻ MຍJ@aP{L4p :Ad589VIbIMTbcLax0txL琳琳琣琣琓{oӗ14]!P})EU-n{85qZ`YV"NҶvK'5 [ʠZp# r̥\>>"U0_ctOJdOJh>(Joz_d f=^+@Grrrrrrrڼ^G-̜UAmkZ6,_W㬜/P;ESVP[QQc5ROfݷH?2)~$GB>q6=dpe:}i Cŏ>qpD Gb5fK7n[8^2y$2yqG_ب_87꽰j{.,k$5cP%Dsp=$XaPj!--У!fc+; ]`",tIrEWP:~a&Á]ëp}2Gln 9[NVzdviUM/sÙf::F>yP͎g'Z%DO1w/ K0j%c&xMb^*r}l37O|?7S"pL0tjnդ̎B|b+º.c]^$bVг}-q*ɜP 9s3^Ce\ tErXsp0A\d >gwQf"k&UU"C^QgGۧdNط`M9!<ƠfTVlvJ'fO~j:B_* S jk1҈a"P}z. j l)b?idzaw9jT03X'o', e :g;?vFC8F/8kNxZ5)l Tэ:Nӓ9l`dN^~XWou_^ KA= K[mK,Я8z/JZMd> pesnF&$k0ˆѓ{ QKpu#|֏گp=Nz'r}B 8ןp>hQPW>݃>0'IM>;2}P& ePf .hh"cGȤж}C} f%^C}0+}?&ص;xun#2ѵUҿ>Tu?N8V[0za&VOpD躡èٖv|Tو P#-vڄg:H؃2, d` Gj3jJUѫ~X*ћr}(w2e)˦\?dդEɱ.m U}*7"'oQLInigpV}*N-oԧao~qieB Sɹ/gKUbVF'ϊ_-qȿb) UԢ?N6D..hjQn͢QU' DѪMҖK-_jmZ~ևõOk#K ˴c_ik77k۵;;x}v>YVX]֟yo% Z^}7BQo>ԏm&]IK]JmdUFem̒Y})_e?_KȁrV.$htyV)m&֒r}%GʟhyV/*5ȟ˟ker˫u!9Vަ4|Hȩr.z''r\GZV,?rEr~5@">Ԉ#i,zcNOco|nl_3JJ〡'#"HH=Gݑz"/OTE}j2R9WE#zm9ҪED#m6ݏ|mFF236YJUf;2je%O11Glsyfh>)G3ͧl9ΜgΓw ̅.sHm.6{e2y|\idG9,2?3bX>mn1Kl3n~!LO`3r4/yLl K-:Ymbk5R~a]`] ˬY__Zrk5FVZW[Wֵ֯d5ֺYnzk5^5Ś.aXOY5Zbt^^2YKFwUeXƉ&k1n5ìC8k7 T60{q}=og4/ik_j_j־mo_e_cfǑ"bbD6WGyoy_{zx{sl5ݴon2uhn5LY.Wg~] 4uU3|cѝ<3_w6 b}ɬ՗fnP{Hu003,a ca~"V^a/=<τ‡sc`=.|*|J 3(=1_ODBOKLe-m+R>XQ(>=sUo"³">o l㯋v9.CSv^2DzKq En1{g7 ȞH죽v %v-n9sԼԮjݮګUrVم8],XMy5d75v]n)B9:~ ;YVv5ZlWTMGy-9UD#pl;>㿥˿ݎsmk?__K/lH%^gGQvfvo[oڹ;Ym|v]xEv^9Hj^l2S- ڴ􌃫[-C{VyLQ4C_btבXv-½_"LDZ{QI98qP5GPM}'TH!ykq'Wt!־ idkuQܣ/HUYWWۍEuVyr$'gk9)۽y~a3.{GO&Aowo${Sz{3):t=Io[c5z|ꩾWnD->}j7Lj Wvza0=o8N]$zҽ]ܮ44292iiW+IIz}og{}O4'A ?bhO'mgC^c؋rB{QN&{QNIE9؋r:n9As:&H8%,kP*q. ΕAsMP9\89]s <rng_Ĺ}G@n0'LufYj:1wf1w1wcY9 s|gs|g5s|g-s|g wg+wD4WnT"G6Ÿ+Ƒq0no(rQ11<Fz2L$#PYYG1X!g?e'q^_ǙOC?qN@?@o??A_\_ھQRhk*p&Wk;Z\G7a߄oAOm6Լߎw;(w-G(q1p1p1p1p1p1p1p1pH1PфF2@Lr)Ŀϧ0]|=e2Be~6?SBJ2 GcVT֬4^cw;l֚`6 lHI2)(r "P\>7 44.\+ѷHsJ EJ  ŝ ':H܄΃3 ec c(hV)%K?՟p#nJcn2Nn'*vv;S9A|AEEȿؽKKL!.#ط| ޕ⫢v @S3e`Y2?? 9d+%(uܾĿܿ|Ah Ѻݑs ,;;zB:e}{fD\A?R tm?\8_0.O)\Dz?,\A4s| t|.3@H3e \ \\\\(VJ-G-/n;bXBݿ^ʵsV(Ol-y{]GX'fPk񯿾]./'vKq7;+_kӎm{>~OþҳCَCd a}N+0>.|_Eiw!MҎk#Rgt9$Ѱ Jq~ݽ߈smj%_ y8rߺuh$;Ӿ8t5VƶC{~¾rhLH֏#Hq=ӎ#ƧFPwPU&إK? mww˅?cm6涳i ۷1ƋvZ~I{"g<}Z~e.om;hfL۷0]aD0^uߩ1s#se^O£6?)F?|ucG#VI/7}*udFīw3bΎ8~~ԕ?PVpfe2~'@7g{֑ۀ],k_ᩈgnSc֐/#١|X=MJy+MvuUZ9+Wq|{}r "鏮8]vLV1>g#ҟ].7FHg?__H:aL׏cGwȶxh.Է!^K1UX~?|Žv'raQv=g:d}.:/O$UǙt>u1rdžkϕ?71-u]s{Z\nO+FoCSiI{C$}^lgʈȓ;۳wyTzΣ|wlo8H|IRװdmx>^~^ЎB<6GW[2yIrHܑQ|^a~Z_Xq+( Lj%IWLcfiN5GKa-Ȱ>^ZO{B*<}N?Knj}O"ཬ8=ވЗ*1IỼʶW z7Ҏȳ7*P5J`/cď;yػO$CNi1RO4<z4;[c۟KoPPtpY]sI!;R7ث2aQ6Ykڬ9US׸!ms3ݒuȊ..Vq8wMP)Z@%E(vv݋܋Z=NqEDr:Vs 8>sp QEt)J\»t;edSJQ/ai't+o92ȩԠNMk;ܬt籢Ȗ\ /Z_00.tN?T>JΓ '[O l] KH~@9:R3#3j|=FWy >J7![Ro&e/Qy5V|5NL rEA䊂Gg ~\Npr>p _:B50`t9JhCUH]U u5 u.t'' |39Bw՗KJ}-Rw-Vjo}AN}'z{ߥֽQC5ܧC}u__ߏ6STkcP҃ДzC)W?10=z8H=(ge=cG85F'D _կd=e)ȟ=owp]5O`g\Yzz2GAsyzoEm^ ezYW7M٬7 l[Пz0! 5KYg9_ί@6Ss_k_ǯ~}:o7@l7Mc16 lD~+ZwHf-TY b`-Z kA ւrP`-TY `-ԜY 0k=X `-8 ւ1k`-WJ: nAY0;tf?F3'G Z*Za=Aj--CeeeΏ"jVt%bg&;'vEyHD%3!RcsB 6`N#xj$߄eDb'ĝMg7 (s2E"*o.6S%tJ\ _iU*\kE:s=U61ͦln27ͦ;'ۑf.sn*kz{m^s/,3}b?rGP3Zd!~<f< E=Of~39ŒgͳT͌4#s>7jƼ`^Bz qfN4bGͫU}ͼSTiyü0E`5Q ̇T|d>c 9l y5a|?PBf15 -1KL*هʆQŰoُjCp@8ʇ#p 6D&JRIf"%aT('#L0Q%48\3,C7>pS)ON-p)sT\y&D>|Nm1MSDˆE(Yt}p֢jq0›}a̾0P/\3x20?.%4~\Zqۈp{a~n/ Xi m/O㵹e Ŗ̵.텭uMuSX2gm/l5M}᣾pㅃAO-pAskzaj"\z|e_#j'̲~̲0 u[- 78|j>͗gc};7h`!j[x͏G~BCꙥ\K4jZҬBU0kZY UZTATʋZ91+"2ր.R%d01QG*/jD#lҬTEjZ0f UYarX;h's28 JDA((UJ!>8:JUDG(U QUxD)C@UG454?O"=8J j>>41U=TKSZ9e߃qD]:!tA:n/;7ݩD0a8sE:tw>Da6|R}#,tG+"lFAU!d] THWKN#F8.m2KB@v/ܫ>Hpn*%AtT c^A0ὔbO]ϼa WKCF A T{ ==/HW|o~ a=VDDb~IiwAmdw-d0a !! !%888 @IVPjBȄ%,G(P,y Gq,R"^Gq.ºQ!q'3\wW~z~ۤ==>3xK >ݟRRR R?*g g&t$uRN^?+vRPȔz])&"b\K>2<>K9lTqʓ#72U1#$幅˽'a<ˍ7a/i~#coAE-jgyw,ў5R퓒=Kx7 1G<.5\c=;- V6[!?LyԖ4|%g&X ɖ`+̔a4L1GM9*os̷zfEyfsTh'ԝK,&q"J-)+,nXa(ѦI!M'95[3LTYJmgJX:5avӖ3"=gvN4l3IӁ3ʟpy$9Ͽ-Y=`y|wO;^RuӦYJQWROjӝb%Ylb<:·\ߗ+ ΍3TE wyޕA}_tW\bණ뺨p#m{^2uyUsK zV|װ)ifK8eKVҴV 6UY\|%u~2,ה >˫m-^+=:֬7,@a2^VʐVk~˼2ճiȲH5:pr8nNYv=},/5n嚖ghӌe8oy\W,OQv)Mwx䕴nWj51ʔ'B~O|.g{C>J^(3͈/jʌVcaoWs<_k{e9Px݄vLYxs:_w,^ =ށ\^#촲\ S<~`%{uwY{ǠYeYϏ(_KB3?F8hi˽?nv JvPY4 Yv[,.aQ?΅]`zK=eyĪ:5Jծ}5l$ЁMHyԝ >]UZ;Ta(+k7e[pXNuy֫s(8O.Xʜ (W70(l傱,נRku]Uj 5cKL2&zwT|Xn]R`Eʭ7}9ώzˣ.Y=]uw[$cүTb}=n/C'}ٺA!3*tׅ9!ٳ|źBnN-!wQ,jpDԭ %KB)~ B)u[BpG >@#t'ѧ/-|ݡF'S(Jiz|qlISnkdaw%M]o|BK92_j)}7ZJEȗ +BXV w<-6^\o @ @QxYkqg@{`-7XnK\m鷥n !͵\e趶eԖ <-S"߭yr<0[me[6u[5DvZBcc|vu-6eצ{߷m=ƟjOny{i8m#ԞCzCT^ubR ª=[gMh`⨵^nE:}mijϵJ lDxԷ}!lӞyf=/z+}mX_g[jmc޶%<~!ٶm*y۽kzv}J*ݶ#h}\%ڧb2cgy(Oj_ԏ+11: 1}]?-5ϵ YBXܾ_/}x~b!v;%mwӁj\&ڟ2?ݐ_nNbblU}ا(j۶Ɗױo(+gI(IoSŹho525L9?ߝ?X:|q)֋?F|Oyj$s[jA/?O)kF8e'+WD;@6հ_OH?O(6݄V\k-AKd*lOg.^ ZICt&!Qk=c|e" +%(§O6Ku[a:GI{mZo;svʡ%Uw[n5^mKoݲE{tcޣ< }~!{ݺgRv[(}T7悩J-Ssk9asu,l޵4];=8w@+n9u,6w̽mP@[\<ܖhiKVJcmiD[fy-l[~ɼV90/فyT)5oU+süVwjWm'q6 x *mb0`>jsO|>Z Qm=tl[zhz9m\SgۮofytR(0mfO^M'͚M:m>ݗȑym+)\zp.42M.nۆ죶]%жʜJ>]v:} ̒7S=`;&xr;^ɡ2͸S<}kN*Ӵ΂wm] >=. 8'x@_uW_uc:4_cgbz1Uk]3Ǹn ӓnWnI>0KW= +9UW 97KK[nInJfWB%y z춻7L<>żyVL{Pr 1%dy.{f0a+A=0j0ڽ1ƽrнqeso*Lb澯D>+A}} ֱ}bT Amo6DG8w`_Jd;NjHvÎ(CIG!߾;$5J)#P*wǰĄTH*>#P k:`g;tRVG$v\0pRAGAE̎NvԜ̭.Nw\2&CTa0KaH $-pHwȆQܡ єS7 &-3H]yaQnX;n֥IlE;nHcsmiB t-þ42<KKˆCic-0;nk7[[Mic'H{'ݎ#uJR}JS^Ve>^Q}O=jDYėQ3_BIg3V|g~Rb!ĦƾRc/^B[obc>=Bw5_Cjj, zPjB_E:t [ԃ?_T4oT "=AL* HJQT2eT2j?Q?ÈRZP(ZQ(:R~RU5U_7_=oDu ի꿧$_7?ޡZ55oB{6ug^㙟94g4mשC59o5R_*P|AsA֔jPi4_\Rj5:UFUƭ抦GYMfXkFU;UfB󏪯k4k*f]5ۚmSQ4WT^o4Hs FUoFG~䫑&2#3GU >A_EU~g8DND\ī99ӈNDF?EnFGnEEUD|1*#j*:7/|4eFA` J_!Sd f&f`<2 l0l6=&}&fl{-xFʗF*瘻o sy1OY)_R?$:[DQ~Tq(}T?PQ~&U"T?V!ojT?S Eo^P\uEwAc[/~%~Pkկ+NJ >%F$D$?HHDIEdFdR""P*%GitǠ1T<9L$#4&aB)e**XÁ1A3C5fgfYdVu!;dxh鹴B,Bs*j>Yuño%vg^v>M#;N4 m@Y =gBS]p +I" I2 ʆR**!}]@_$~N@uzOedtY^A$WҟvHI`DB߅a FG }M@JC?ϐя!} [I~&( H!}Rz~m7:iJEE|*l_!yš"w1B}}zz}|xEEwJoSZ%jB_!tWߠ̔UR,ŢR6JD6ʇvP-X+/P[T/ՋMOK:Yj5S OZVeXa<(0 .3_Ƙ"10わ1͓,SS R-% 9F+o ^X5/ DքM ‹$/[2{-!Zp}I{C"‘ ΛT[mQ̘- oj[,3ނmg8[3 T:ٖ>/t-YxKL[kJwB,!y ]b+_RjHWjXɛtc5l |oru\Gl ?اE^b[g䇴 uA[sc|ۮ>'C[nУwȸ&=e{glޏ0K-ӋwǬ&fCq+Km[;MH߱a.z۶w*S<}$$bo{D6aUb??=~/a!6V\䉨~gQ6IgͦSd!μ[{01!b2(CRgö9[|b+66='*Ox6[26ѺKj|ݺ+?up\f/l^M!/A|ɽ`;¾Vǰ=n{ gOǶ3;hbs}f "v~e/؛2l;9{%efu]޶-ݱ]"> p9#11p?+9ݏh{g%'kyFub9)a_ۅ}#`\}9geǸo |x_H~9\0M1\'XUw`a᪄XN}$'Y_ ɰpb!z\ZH8}%g/q}EowcOܐ[)OF%7.EqSR,qpb-fq`N(%awSr2pnr+!.6ݑ2m)ە}@*6 w(]H!^6]tbvicNLm~6F",ﰓJl6{%cm>ċN~CgOgg3 cB3/wX!ޙA;Dg6) )<B,_u^N(p[(9/bcT8ʜJgB 9Nwʧ1yNbRIx`v**+ۅcl0p s{H3'99FX/p{ݤ Ǎa9 ⶅcgS\XׅcwwH36ñ׳q׳1n+>eI.mTcI.]1Ox\eIM\@@b,E`9/ɖ2ITJ"RN{V-Zi^Ǘ,]ҋ$MZwo0?9Kt+-[x KO#1i {ҞeZ: YQx Zǖ%زP?WG4iϦ#,]G=a1#rߑF#r SG>)yrR#3|C9L8.98\?!.>#Hу79x8F89^vLc8q w;ös?X:ñM~qr}7%:9?g~ON?GrXZ.Fqrs8h5A&4ݚ)k9?sklyO~+%HbaēA'%4}u)ДLĭo.cDzKށ_!#׊1no$c|ۆqmˈkLjh?QFϑQ(v~GRiw?xʜƱW|z|VlDlLlsc#׿c_R$ؒ4fel>??/:߸cZoVpo^ݱ-箙m93__J͍U^{ספUU'v,v,'z}NUU#c5q'W{8ި%ޙ[75Wtoo9Hvi#6W:ޡvzׁ{ROsxo|~.kX:)t*>+$|F$}WIY|7DDA\߉([H'XHܣ1ߛMo&I,E 8>1>Q#%klPWg[+/F$Iľ؄DeHlfciߒ3I+ &-cK/%%KMOޚ,N%GH˥ce3dyrBrrlBrZrYK\<%&''%ʒ6#si}rp#k7&$w$w%+˓͕<&%O$5)Gf^RyFĸԔj[j1AsGw_j`jHlK*ۑVtFƙHH%SԔx$5=6!5+57>.2h1ԓUezOmNmvʵ;>$l Q1:VB;NʓSM=͒KҭXEkHIߔ$W4=<=:IG]rݓ*1W#qieuүe֦Jw-<|~\qњ:]6)ucv-|^\xn"ChWtzA֗\kCQ֒ءDŽNU ICn1ZҵJ%$eCR&y tCɗnH֓<[!5o?!jy?DcC$v}cѹ'kcH~H)h3v>$y<$.qP PusZg=GP5vS__ gEϯuֻ^!<^b.t܋Y)"w\]ۢ&f>i$I-*E<ҢB/ϕ#ELr`Uo^/*rMʏ6Hi=Rw俢Ѧ%C+J{^/S s4N>qϓus:9nNꕝ=+49:2ڌq$j"5g%v"R:oȾ#=/=Ŧ',dVՆtF mzk^|=g]'>oAiV]p|nSW{6*Ӌxej6?i|@ߎxuhFvGс:T_WG͚Dj=Z+OjVlnAǛWEExB*=Nr/(^˞x:Ų(s]D!<}Ckrs9.e?nd#L52,kdXƏ~+)߾B2_/jrP::Bߵ+?GY]Ր5{QHԻiB/ txv =u¯g"V$W`$?":>1-r]oH1TDhrdZdfdN@:($ZYYr"UcHMSWҨiI˒6%"J:(]үd`ɐHɰQ%J%YZdJY%sK-ydiɓ%JBϗl. ,-9WrxuRwj.m"*mVJYi\ru-UڧdMJJC&4/._\ŅB_\hd/.4ŅeB`5˃݃}cqߍtN߀ཾ| 77w O2?*|Hfz<::<= QCd *] JF^uǻѠu̿ J}jnnn%WAkWOp(\5<<:w fKBo63qYx%҆ذ;--~oa12`wEݾ}mӃ?n nu|wuXu?:7w{RtO.> ](ٳVNE7_=w \Z,Mؙ1o >FnO~e? s-xJOt1#_ u yE0Th-#: ?E) ~]X`9M<-i P /!jV;7*qw HXTw$ xԓN;=e"*xzzI:|\1ʹg $RT3h>8AJ]F(u:kx>$3F򂖢Z@, iC e!@t!_F_3<-\G ўu*"*{ҪJAwFOcm1cm1$6ڦ|JӻR;A>59X~8X!6>טQ̣p2c}#RiUW}UG"j4xFёl`M)b{EN G]m-i=ІH#iO )oD{RcZQ:Z LDg4xz{jlğ ԙ%iQX5H¯33*yP{'>_欢^U!sevQwH9YN7E{.2w-RvO3;dȢ0 rT8X~sвNJxG@Hyy" 'Gx9%f෻=2C w.`sl|6g,퟇=MnY.`+mپ9WkC߆G&Gn&S,odFWyVQZ>I$3,UMjO{,Ar~D,N=$w_ck^2# ˌF3[ż[JIsrvE9/2_Fd1s?y!san+~"xXC)4/Sv}Q: #;(k9bڗNW@z}/= ~${,e4OzY$SrHO9mX!G'eouR'/3<} ɜ]܇?*b4ޞ9/.r?YwӃ]JO-o,dNj/?ӱw s$?2F5v*_r :{5=:/RSWjLJ^kG;'i0ܜL4+jЯ_*$h'a?_JZԏ*/KkoµLOqˡmWPsvka8gX荵=#nMveh&y@wѿ9Tt_eG*wmG`!4{=HfWN|VTo&IJѿ>gv+BKiKgT-K?h)>Z 6aD̽V> Ӟ*:/tU>0]ǵp2G}^}<+⥱xi,#5/) }-~(^HTO ] ~$^ܚ#ML]yz^cL f=3}i&Б4BC2ǚ{u}qu'k=;5;w(o? .UӏΕHp ~CF<-P̹yS,W?TwYAzuڰ.BEF-Ew9:ݕwZ0YC$Oi3@,*puݨ9~\xuʮ`炭oXN㟫/ëS<;8v6S '9_!]wSq^ouu&XOee \3h6+T H3hRgTA%/ّn|Vs]Ē|V3͵;~Վ`TO9ݦCsvνE_}'Aݿ Ϡ#y,p3c=́8܅+iWsA 4x ix ަ{e`|?~rg҇8\uh-r3zj5:wwW;{~sAw;hvʹ[΁?Rǎ%}mϳO-=Z z;װ tN ԫCZW;-uA$ExsRM'yXhR%]OK=JkN]bc{t-X=Ky)kPv,߫mpk-ʉùϼϩP4+IP=1MҾt]?a'SLSۗzNwxh/f@R''l&ގU iI05jXTөq([P2=KFz?Y. 1\Xt0jSͷ_Vpae*-Ht^Ǿ/x!޸ =;9ǤwPjDVE(e--Qp]gXeV0}<ӨX&:r{~*gjc78])vX3|h^{+Փ?iJ8Sy>\]ez8yr O(ڿUҝ- o}zw߾*D_U^[958qso^`ZQs=@,շNDIa-m1GbXyL-Ĭd} _m +)݄?m/do{ yلZN2YY5y1֙ym<3gYw a!ي*q@qN9c.ows=o8I=\R֓hu,2-<_`!jK>wr%DӿhBp4|X{B01uxI'X= =^l9~ڋϱ4rR^ea{ g,Q;o쬑@ܶ h5m,MϩA0跁P%w9`3ևX:t>\$L'Ux)p1moݿUg*S_ү-W6!7eWï*m$oCGV+}|^>pI7Чh? \^e}_]IH#)m`v$Q0$|B HƂ|T_"__#P%>vcZb kX5W޺ 98sx \WsusOt1י~7_Sj7}%^/TWE~jZdLM(e(#*E eԥx=u݂?/` j1qBsWOJW#isgw`#0G1bQE!U~ދk;/&2kVϫ)^fX3|v2z׷Nev'|83kJxRȻQ:,NPK )QN3T~>j ?IgN-&*Ξ~JSlPیytY[ kn:guNE}_dX.~5^B"-6<\kzb6 >Ur~8| 8$ϚrxYS =}/GǞo8ԷD.Т[ԇAy|k[;N$i+X|WT;!Koxfk!3:P^ \Dɓ,%KwsR_Ol?Ii&}aWP[tDᯁ_CiO@C,Y;,[Ȫ_fZk)Y 4WvpG4mx< 6,0mVy ~ fu#*XG0@J< ʃY[#yI_p4u"nB +ni?Y_y keX(#oT%Ufվ45.xvxloF46# >;!2d@V)f3bWQf5#+B gwՕH|BlC6MkANZۀ٤:y|4؂_jٛ4+|Q){?/ݯ_y_y-9;j-?ΩscG ;@s{m_7]}sI7[d}`jqJRt7+:oa-鋝3(lԫh;-@uQȇ)YʕQw~E7*g;~ F 8\kBEQp+/r"ķÖQlScAV){f{{r-u\y#o(rC]J4c,~G٧hGUжVg[frW4ٚ_MyO-NoXSgZU߿| zXp~_,itSHJ-[:m-wtd-k UpBVT3xT 0Vy+c9eIZ㕷XoG 24[Pv_wb֪{'{/j/mP;늩O.8y<_0G]W|(N y QR/%[>5H |Qo N(W!i6TڀO?1t ?O~z/(􃏃yuH?0$iO#ŸUlS,A}Hӓ`sk x?ca::CC~6Wްw)VNZ`Eyx`Cf3:;1R NT3Rʌ]f~zŜ~XM}xmXwӞ<=K4Sj/f[ZK_U&?AnڶQ8"hR:Hs\"9p5e3XC'yZr/x(^A'yec>?A?zx"$PN|އ{#Ms/PVڻΜS 8IH"" "*a@D@$ d$""""$Ga9$yU__X|{׮TQ%Io}Tȸ^9czA %qWc̵`ĚAuˡ!7քM J_@l}gOFZpŚ Ě<60klb{H6=@F/u5".@ƌn ~Z`aXew c`HQ"*G  *^$.F({DAzAk cNs,•*g__dZ kp "?Gal)"9#+#3XnqcaUYl@)"U\_,Fc< jv< <6:Q8=}^Ȩ+B?0d:~|q]G@?KK K`9`?2昻38 aX 'v>`Ϫ,Z/Bn AXqo}gуOFyh!ǘ@x$,砵!_M}`h;X,2zq@x3AhcRI?!c-f&Џ@xYD @QU%RNm2;Hq`'?0cmvNolb*U ':!VG}K>^xfnjOeva&vn;fL5fh8gbA3=ح/7={ %H'V Cعh4k ψ9n6mѾ6`3"jhf.4A؇-67cqW'%0G<jj Ƭc_Vkz߻ӳ[n8̇8s؏fRg酥ZUuK`-d0zO a3BQk^t09,͌jGw"d[k8l8%GݓpY',KqP(zyce>(*`FW;KpgeOCe\iNbJ@ 6lhƆ!2k1 ӎF16z؟7Lړp":f5D|똆hfKF{a_B/-0Әo ? nM/?gF@;!7U*fu>4opn~g*π(Vw'xZ>?=63VrM2 _O,Dh6 #MbF3sM1_G *VC.Vڴ?Wh_0 -;~<᯵  \LSb/[/;iHxx"4 Ӛ^s'W=źadm#4=aY~/e 3^̫۱: &BE~̄)A̷gCJx Ύ5q_DJ) #y YK}'ęBm̄ ץ=3G1kMfaxB=̷Ϙ9+܌@>SK0Džђ]Xk7w;rxZg4滩k=iÐKB. 9dhR 4kufCN|#2igZ Faйa M;qh4k$9Ӽ!w2r3ּ!M^0Oef iߗ-|zL~ 6=i*4Qc`d4i(yĬtf#VT(7|36`)=r>[|G3~A)т/1ha<@?g$Ƴ̼ .̺4ZnF `` `Y*M;[;vnGGgtȞ\\\ޥmV^aIyU.:9 9t)QyXX XBc)'  3888xg=p p'p?(tͻ8ׁw J U8`V`.``1`$ͤ, | hvn=qQu$l&o;pˌF" \HLG? 9׭3)ῌ2e̅ =hfpNS:Se,)Ͽt̋?c~*/Τ9'LgwI:돤4~:JWX>ϪKbH6cv]k|g|-O[",")v"ƊYzBϊiΛ9|=VrG/$=Ͻ)Wo?3ƥ9/ƾzi'3Js^7yǟ}9XD8:>dgX,>IǪvspNjf]$>8VՃcGQd,Zipy4WT4i79ߒlpil\ۗ-^R%uPR#\n/ٌ-(IA '?\n~ec55«=Y_ǴL3?e(P/ճOӱtԛee9Vr?֐5,AC,cCưOh.ч:N64A=<=OOcx&>x64iTT?*TZV)^UCQYʩGT^RX}L'Ʃq:^OP15IMS)=>SjFOjUQ)/՗Z}M7zFS󨺚S@-jZHϪOT 9Ŀ:vBut\Iuj=Wkuhڨm}YGe_R):ʾ@9[猆jOG 5Q%j+a|(-5aM%kIs׹K"T9TY{߿-o7XNjjVN դzP^h{;!!)4M4]wt'%&)M19-żIZcRLo19ż]]?b5f1q3XbñkPcDZ[p}F]c>19#$Kj3Hcr0#0.1f>0I؀q#F&L 0iȔFL023`/Ff|02'`䫀z]b&`dddn7# .`00`ǀE3?,9`diȲ#Y0:`dMڀu#_%`dddCƀM#F~00-`d{Ȏ]#F7`f_3f 90r,`xȉ`d  O9790r:`Lـs#F.\ 0r%`ZFn 0r'`nH4T0̄L̄EI0r\#lƍݴTmD-QGE;"nM$!=1T?GQqL'IqJgYqNEqI\WUq-R>mL4ϊgڢ6 B$KmEg $D1"Y$;;I%ޥ'b@q22eJa+mZV5+كLHEٛ8˼ǷU{YLVf+fe׶/|`=`ٖcI+dXa˵<+b)+k.KϭíǬYOZOee).f+X!VUbX#֊ubg21ML-V_/4s庿?ZХ ŏbI,?%bX&5FtLa2[֭%tt#ܠ[70?mOzѻPxgw]GiA4Xh(rpAUQ4>1^h M_::|K;OANJiDgZBKuXN ZIh5qd6fUGBh;Kǘ=~:@鐎8G(tN)Y:G]K:]totn-Mw.E)U1z^_/ސ7yޔ_xs[o';7d~~ ~~V9~^/ ʯ7~m~QC-#'^EcD&O@D_[1O,?b,~[V"b)vb+8(YGRmvkeX{}~u:dXGcqu:eXgsyuѺd]XWku7uӺeݶXwjG IYE>%ʧe5.kȚYYK>'k:|^֓/E|Y6Ȇl,ȦUl&Zk+el/;Ȏ|Cv]d*e7]){=۲-wd_'r$!=9T/r@~(?#(9Z~,OX9ND9IN)39U~!g/ZΕo;n_];rCܡ0w;sǻ܉$w;̝Ns3ܙ, Kw;֝~.q/ w]np7wns;C{=q/+U{ͽto;nMcgyxG1w;N{g9w].{W5wûn{w^KPExDDq"2D7E"Id<dddd<y(+;'7/?R 2.2>2!212)29idJȴȌL<}>{I\GP*jM<P4]x D'گ3;t@|(>#bCGُ!oG:uy딘/g VEF؁vvJbs9N2~8?5vݛc})Pk;:,Yw'@[W)t(EIJAdE }JkWW╈j ^ uI//=?cϰ kr_͛93l![6-L|ZZf4 yΑ&;_̊=I>c6D̀fײ?΋ct7+>>̽a;;}m}㘈{Iڗjߟ7X/{2z^A/rzy^/ z^?Ͷ<ߪV_ʺwU:!rWkiޡ.w={>VTfsǬ|yYeQ|_n/dڌlVVX]V{!֔5kMY[֖=aY*zQTe)m3Oy2=>O#p!Oh=>O@D"(B3D1-%EUZ޶[SMtNogYu}þڷ[,bٝ,3qF9cXAg3u&9#lgwVjg3{lgM]9{ʲ[ š¡"liXÞY,Yl o٬fvV;asٹx;" [uK0Op]ӢtiE], KF,2"X#6ֈ]zq{ İ^$K%!wUH=>0먆u ;G@|B>Cz1aMXSs(?؊ k ť`4JQfhB|]}gȘzqm?L`qpp~~Cw" qx@|6@*dE֑9Ğ #!d vdؿA (¶öE`?bp{aGPdPt4xQרS. QeHS`2H`2}[7N(u.GwT$gE$}2}G,Cg>B o{cyv+@gQO}S810`bc`88$q888Da8$qH !YC7fE g~j$FW m+BWc`"K6̅`:k w=ME}sCs>!M(*z!uP_b#'BK,'aXXN# VXXBk,cd8e2:b"*#lyFc+`YH#Hg$+e=W\I,{RX~J3'"$@q@[@ўBTO&CP@: :EuevPrFu"tAT$8Յ;׳eEu-EA"FzґEu/\1@ Z]4&xL<628v \P߉S=EF,!KMf amyl$cqlQŢD(6šD).@~$? o%oo5/+xyxnn:yOyy/|._Oy|>_O%|!߈o̧B ߔo7[-#V|kߖoǷ;P|J(iJ@P{5R5HmsbZ v2,щ㻟)ILϽJY@SɩN-rq!ކr * ]&cAl&a(g P}AUc;8v{=n/q{ݾ8vAQ{<_EgHIɢH=g[B$M{S 4ǁXssX(~dQ y][ =`Oaa s=)lO lOIlO)lOilO ,<lOEd7y0T:b1`?O 짬%}W>61rQ==Y{27/[+"䈁&raّh4v ;R4A`Jҧ )cJHR5Al([ʞr&QaTEQ T*Jҩ9T5ʥQK**ʧRj#UBmʨ-6j;MUS5^:@FLNRQgsy"uB]nR]s%z{.w=D?->o)G#p+zL}41/g3!з_  vh1%0Uf1kZ?+:Vc¬z/O#C¬/H?)(P??+(~PP/X&};%?)?+ Z?(?^/>&dn(~@loo?aބ(((jQx߭-?:;;G"{(&@Ng(&PgO P{-doe^ s+/@-ߢ;̏ !aޗHpP[@7!NH'!QMHd 9Ԗ'w)Q[PGmen1u]ÿO裶aچ!j̻Q{"ru,+[1e+2vd;ۙ!hԎa~TNcC>¼݀G" bP|8zw7Qc}1UH Bl *K:8c 듹9b=A 1@A s9b1@A WH`&1@D f"3Lb&1@D f"3Lb&1@D f"3Lb&1@D f"3Lb&1@D f"3Lb&1@D f"3Lb&1@D f"3Lb&1@D f"3Lb&1@D f"3Lb&1@D f"3o{[r2x/P^Cg+8DIr65Pȣ8l}E(!9Pf%H7=6GiJ^<@d,LDaOͱWckI&ڜ$[iY%,`R;$8ۍ/2-w+_&kG@ h)f+ EEG&' %i)* KJR 0-!"Y.!)1!)89}CVe>g ni7VҴPhӒmY˕i'`jZ[>Q|݇MmlM-h^}~wxp:j_lQh?IdCWd3.SR΁A veޅ-IH뿧WnL9{QX'aUgw-G_PQɩ6cR63ddi6|ײڋi[gv\]lc][hчYGtN]P^Z{?3&YAƆxjM>&˖TsJvSlosxf{'B6ȍZr}sꉪ촹5AoyBhs6C=¦Q*S˔/Wt.rcU|)k(r2W.?W5H>?ѣiaơIFqdg8%k<͸όO9\4,lQEЮm?;Ax?9r2-`w_a8//)MkyѕgCc_tOl(yCKħY>pY]ӳr6cTn45qFexԜ2PW_h]a#ؿ{C m*t )Vs/ޗ}Taϼ&S= m_x~iWIyUt<,{:>-ۿ'sꇁtηr7;-o#UPKyהq Z9~wSOqO1rVFgs G@,G_055 Tڽ^ajё Ba/B )e6~%.j]^.I{\7;n>x#ifVfý'Z[җV+Q}#7*~%]B> ;w9.'x7m\պTzV2'i=K?욜kUU^M]@K)'p'ߒ|hqYx37<;M{-7+[;tn">ՁN74D=2n1ppaHe!L|%脶;jki/c)EeNPF7O/)ml&ChZhjAZ 0bnbfa&FA4"t>]~PqZS5?Ei ?F^ 2A8q~/O)i>sEa8QÑSwԳEcشK]ݟx]-NM';|Z&HBAp0=`Ď4k4F~-R:%l=]Q.׼)Cݕ*5Z%-Ya|Fr-YoVp?[C'{NT.iQƿ۞-d~. {%ʎ= V;%_'EBܳ(:-[[w$~-]jyywb疚_SKc]XLZ#9e7ey~ZmE,XZ59]>&ղnCNŲ/F׫즜H;S}` ?.X|]S؉3V:y3e'Bԟ}$3V>4au C6G.qmS˒ NuU:c\=ʟRmf=g\8&uo`ִn>lrj|mbIg;MW*\ɟ=YeRbg׉3M( 7rQH`0b~iȱ7 ?sV7x"׍NW΀;=6M̆ЖMxslWW͜b4v֍us[ύٕLI=F%ok'ڿ)gw.xG}!Z ^T24#WqM֥ΈTyVd-#/\s9{_hq^{,1+V ^>n/y^0M[Êbg!5X7b[,Mmr.5.*{rIڱ&CJQSo4ث,^=h/ٍGx}ꑭDi쒁oe 9$GkL@gtLjgd >&׌WVZgd.Rג]cӞAFqĮdT_}'32POL;ſÉ=z0kɂEX+n(yj`_.HoZRGtWxas@me@g;çw-'-K)y ^RsO|Y<ԟҭ'ByRj]fFwsjâļ؝c.M?]!#D٦TŐV*qy9kݲmfuǦjJkOZ25N`MM[dKt̍tC[I-5=t) M2h9k<}ƺa Y9RO^0g_uė \:"==7Ƕ,<Q_@:2U/2ܙWU$?Eʪcm%<תDDS[`xBެ~N6F䦜lLgfoZцCi@V&4; uʀQذ0,{9=c&1vL P@cnIJF.oϖt3rz@)?[o,~^EU)XFY^r6(y~t_\,vslX T}`Z=F'lMnas@=ޑ7QJu}͍BrC rn\iۿ}:1t@ FrR98)2>v|ȡ)7; ޖNȿ Kǿ*(,.S,=V!UxۦMר褙fc) _X%_wAW}'Қ߿("D 4"x]RNvtMf:WB_ڧD/SၕtAth0jERL?> IQj"<:ötk2?ys]n2צgإ]/q0ұ7ؓ^Tw"]Tx7E e6z͗k%;㹤}ԇ8}"+Gy̎gcEzV:Jl;v\}Ԅ=jgSCVKq/$qtkhOSGN251g*ɈkQA^J|%;豋eՆ3s_5#jji6wqل,%]s-:[?H+wIBN [('MiSMG\Ϲk%?8+d21a.m]ڞX wtI|KrGmOe]w>%{>o^+ڿ, ܜ24l_^#ySFlMf,~a݌lq n+y7t==Y2_YSjB1eiZ]ځǹi57>8l]Ϗ-9wTKt4:KJqj9ɣ<s~@ϱvN3kR@x#I͉'Iso|w*%f qs2^> stream x} xEmtw$ݡ@X4 @BCšEVCQT42.1:.::8긂{{bw>~Ԛͣg얙o_(UR\XSk7oM+VUZ66mo>c-ZxŷVG16kɋ֬f?ZT1t~13KZڟK`gH/YѶ~xVce-+zd]嫚^<]-3!9kEiEn{W6hwߙ|7v5m=nvs@nmYݱx5>f }K͟"if zvǎaLkOP@6`Zs^=3UïDIM_&SWE 31ŮWE*L{{蹌Ux o7 dKCbp|ÄCufz񥥉\gH;R!ϩ *"qDN^KSUQZ$1k_B7f76-+/'ͬ!Vt|C=Tazm0߷:+0x,ժʂ)\+_Q./|kž]C݅l(ƗaR2+:k=fEZwZ_j[,x\DvJiYXܘa*nN JJG#ÁҒbFKG{kbxJP'Q6AdjwZ]_;'}Fԧ- }ӮQiѡloEKyԨ>pk?OE"`0 \4,&zlaՊ _k;7iZmëdI)/T![&2V-=^K&']%&ߤNѸ/ baІ̪KbbkVtU6oegCwOGcg߹~HцWS;ڭuF&6OY;gOi_c"ʍy|AjE]cFUSlEf`ZQ s w  切.Ӗ#&FbکM}xP~]go7,[7VSK7xX97TuKR,-8u-,p&R36KМ%5OlI}: َ=pxYU/ڂOfw8YD2pS}+,"Y$kd5GjA> &sfussrN4sg_&[/ ̪[`9O,R'EJq(Rl,)KNRK&)ΔbX) )KL3X*)KH)hQ)X()K1OȒNZ)fK1K3bӥ&T)HQ-d)&I1Q*)&H1^J)*(LR)IᗢDRb)EERbä*EC,ERI+ )r(EYR "S )ҥI_4)RxH"E~RH"ID)%ERH!]h)lRDIa"Y F) RIJH`a{8!q)~GANoF_I_Hw)>I7)>R|"REPKqX?IJG)ޑm) [R)R^ץIH/IqHxAxNJHxJ'xBR<.cR<*#R<,~)I-CRA)H[]Rx@O{%oG_KSK_IqwHq;M[ER,MRlF)nz)Z)j)J)r)JqJ)%R\,).B)䵇k.=\^{py嵇k.=\^{py嵇koBpy.?\py.?\py.?\py.?\^{pym.o;\vpyv [s(uwP t> uP\sBQMHt6B)@C)euDk)RkZxf(hJ*h9ѲP DK-&ZWjT3QQ#QQ=BTo>%CTGTK4hQh&Q DӈM!&L4hb]"rO' '*Bɠr2RGD%To,TrH^LTD4h80jl(Q!2h0Q5OGr$&"@MgePD>tyRRCS@ID䩠x2KC<D6(ʳY̔g"2BI@PtH%B)N4=D'"8~$:Ft~D}KM(q&PbK/(g7OWO>& RRJ}Ô'.!zRoJz#0 {;׈^%zLHT9ߒYg&:H|RO z#z=LhQ7|R{$C;_ 為DOtѽD~yV~M&WDwAt;ۨ[[SD7m#*@뉮#V&$rDQK)It D[. @\ 6\@r@!c~n5t&M!jE#ZKNFng@TrreDg-zKSQf*DH@TOhz>l\jTK4;Vf 󃦅 &SIDCq*JM OP9PPy(\PY(T#萳4hd)F1QQ94"9瀆QPshrboQ\z jl Q65E4((#^J'Q4jKxR^ Q?"7Q2QR1r,% AD.8X 2ډlDQTJ%-d4D*:2D 'b{Gspa_!K|3o^(zC xx?e[y6mAj Ch[yyk;mӶŞ{xcQgzj<Ƴ?ͳ}/ o7l! XoϺsugo{_;_@;p l6g:`-k3*`%X,K"hF <`.0j, jt`0TID * (Jq(c(`$P #0`(P @>` dL H|@  Hn H pq@,8`X `L0z@7*`OǁcQ{;[kW߁ρ#g߀O>>>  xx&{uwk+K!Ey93A)I 8(0t{=n tA~>^`Nn.W6V`;p3p  \\ t[ Yϱ9?csϱ9?csϱy+3 883 883 883 883 883 883 883 88ϱ9?{cs}ϱ9>7u!qƌ2v⚓~z;a8{5Pv797O_ԇ2sȉn}t5H?Yz=b5=݆fڔ`?sH ie ]y9l.zր7%l)<-g+J-y(D?ZVׄS"L-!gglm ,AKabfckJ2Y6 ؅-bv/.URvrv?[OJ]xZv݈uq3~~݆5#6MG3Av?{|G_i>\l71o]:#]}jQ܌ ̓he)c ӈ(u6}KV}>*/7[¼ z߮Sl%'fت:yV\sKw)?}_,/|pgSC\b4|a2 hGU *jUD8Gzܠ+UOM z_bL G܌y)FhP&cֈWLqŧĘL1);_飏V5Wh1):;51i਴YXpƛ1Ψy/rmsՌ{{r^~걊 !?ߒnfVӟ>8*ʒ]łRD ? >|5188ɚ VP,,缯q:zxL~app XGB>gqT%rL.C)ΓkRNVWJ+5ΪMqޤDoq{ =EdOf ;6*eQ&c-FUgmG%gޝ:0jMqaQ=3+RdWWO ?9,v|~GVoMpC'Nu#%GJ8z؇}]7`im'8kԥfj+=BntgMx©8Ob7|w٦IƥWHgt:xf]]m_0Lma6٣7o3l6Tgia<^c_;d{xڻz;⅑%[yߜ31V+bKbxb>&{N`6R]IFL1P 1Sƌq#Sli)Q:Nl˛\_l_P(|謦Wl@>wD*KPI><Ѫ+.ppu3^|ʑYVVOܴmQjҀRj-_.=eK\xAf>y9ygh֤󆗯-̟p*ob`p`yARc`@bsߑ7iܘ4ҪAg,ú,R,abxgxf4 #lD#lj8qcā'&/.Q\^:T̙7|? Nr~ 1f`jQX(fE r´dItp9ih?1y[Щa碜hwcSǵL( J4+}0v\6ܴ60"ie,ꅎe Z/t?cm>򧧧ޏ<='D5xbwa6΄kYvM3;EvءDQ)*^>kG}DNؘn^7#͍]px>4P/5tx3A{NMsLmwd.,xÜg fGM֫E$$zc ח&;FGrlLӬuEgKMp&: :cWqTۭvZ-{8I)<3[[<^xn2[Ȋþ.ޯˬ+څ;b,Gq7ϒ)q7j:LpQ[S3"v, z/HCaKn>>,e7{ԱKc6tLC(ըSQuF-:?/~E)&U?1_HKMHq˼7T?)&ewD}m{aq 5Uǜ=-4>5IxhOKopz8[rZp-GmFaG4oi+J]++&;Vq>2D_,SRv`uf\*7N 3zX%ڬ|tcRI^U-֦ _#ߝb9|J$ď #1OK_WE5*7Gѽ__Ɠ{>䗩=\?Xj VuLńt5&u}Y:<}FV&69̫ kR? (6P72mʍ:Y&-7w5gFMa0ӰVYI]]2zeVnd61qUX<1-|Zoy+1 (2_6>,Dᖿ03LLLLZק LLLLLLL|!fàOAUlV}z>CR,9rD/bykT %Po94¶%jhY+5R 4RpR,F(܎gbk چ+%*-g_X.ALF6 (siMB,Zl.,<:˕ОJmqxjm,3;mx*x}Ze慥S~ڴq[|)^+ZQ+SHxmVF _>o}r`e0ǟLkҠ17{#T[as%djd2)#I8Qɒ"TDHke,[FԖVgR-Ke ^R$͗zd?Η..c@T)ߑ%5%6fkNc"m͞Oɕ1(_x(X s2s!EKFYa[Y򨍔֞GdOZiJiaVӛU5o&'>9{'>-+?˽0+3,̷efsv;9EEN{~,ONݝW̝oϣ'k>-s3y,w~}Ǟ)pgY9vwdOǃtZ9 Hv;5> ݙkhqM9\ޕm-_*9/+ |"{FYtbq; .5X͝|b{hR}Q{~]Z3椻q,˝2-kvANI~Hǝ5?=O@zɵKGά={3^FnMߥ3GjZ#:'zI h1E_'f%fRlFWl`c86DlX@e%聍{Ŵ\MWF6zavl$l܏ l-R6t舍6/bÉ"lZQ#4w%: _q+'pqŕpJEysebT,fYr5A1E)(:KT; Ÿ"ֵGPYct(%v[M$b)s9qsOQVRFEo2UYkUz&C*\ZtɷSA&쒼lrntS[پX[%%n칱kk>n~ܼl3)hwsPA1#X(ͤh5)!cW?cikŸp%暛:CMdžXwӱN[S{};|fm-ƬX|ޡ}f"T+ btcYG)%x.ʨĘiYYg|C #Uxt/1m*WF 7ȖGfXؤ!Ef;kE(M.YT9E+EDh+1Zv۴S&Hm啞77Y70$U2ge]my|O?O3y>-\1y<%~m &kG(1Eqy)q<>#uy,[VL&|4r=o1wY-DBx.wRfI[r+aIL+E{KEb&wT&wT2#e.n(tu.ǔ{쾥R3)^=(}{ Am˽wy]+j|t}}c'JyHJZ~E=~?;QFNqFWFFF~0gF6&e {Xp #z&O2đL!KڤNZ55xrS\jH=0KG3Jm?bY6O'ѩ~8:5f?mfڑ{=٩yj0di'MO{`׌Le_m=sv싍sRvqV\.+` ,^z,d.-"?!|+=<<up<\rh΀LȂ9ZamDgwOѯ-T kK鵥1mmm6%Ebz{3O~vZGf6Efc!a0gb{@^WX9X-XJ?J܂GKX-2=}(Wl=G?av ܇QS [igϲJVm/3ZOGFlfу2jzM5^SMTk5jzM5^SA dQ储VjըD JUJ5jTYYYU? j$d,V{XF/dUF4~Me~*Nw3X'Y'Y'Y'Y'Y'Y'Y'Y'Y'yX+1frql1`l41c>Ƭ1b qi8F?Kg@X:ڙu3hGddddddddddddƢc,匽c1WΘ%%%%%3V|mɬm+>ַd9_N/ֿֿ>_N}ɬɬɬZWϓϞQGǙ PbX&XD!; QȎBv(PȎBv2ĩ)v! :g: tnz-Г_ٽ7p+@?v a0FHa wXw=0&DjURa*'{at~~3AXQr(`JxVU/(a=0G l7aoo`3*[]xއ෰kZwJc(c. /`7/a/\=LWәgb:Њ8f<3g`30 xf<3go#lR~T>?3 xPv;aW/,Qm5-Ij\1J|=/&6X>وFfiIGgrP?s?_l/WpP،n~mg޷9S7~-Y~]]Yf1/hz18D) :@G7 f v!l['۸7*kbuϺf Y# `+ bA<$@kh#,C"$A?iO3~ tnnQϘ/ )\S0yL<;`0 Pwy*ԝ{a<^0?Իz߻Er(/g|o `o 4s^hYGh o-lrfgnϽDHN%W-eV=/G[u"J7^~ݩEΈi  `nW7 +ewq ue&<')xrga-< ^lx^_l7aom}BA ~= U}qSvyHu+5ZS}d-s!rxB[ -@lb [ -@lb [ -@lb [ I0@*L4W=N4~BtRGuagbB[t[u0TAطbB[ˈˈ,VK,qu+~W~W~W~WNp pzP=?k O/7g\ĠL?V@j*»*»*B'8QƉ2Nqe(D'8QƉ2Nqe(D'8QƉ2Nqe(D'8QƉ2Nq T*2PE@"Ud e. CG7^DD{ӑӽB;0,# #%~ڃV{F*H%d#lT               J6RF*H%d#lT&Bۈ9"^H D$r$7䦒<$@;'$_I_I_IQQQQU]Uw/s p2e9m<>4-eX.QO[ C1<+V ̍VF+shen27Z̍VE+yʼhe^2/Z̋`+s6>Ƹ1#o<=1v}]c{=|{=|{=|{=|6gPNϛ,-1Jy^ q 5.%PL]+#B) ѦD .%,%R,%R,%R,%R,%R,%R,%R,%R,%R,%R,%R,%R,%R,%R,%R,%R,I F:> oF@HVI_fk!fnۍvn7&*!*!*!*!*!*!*!*!*!*!*!*!*!*!*!*! 9Wn~ +'ĺS[Hp(`zPW X)VꞥZ9x^UQ`!,`@,8hm-I:u䰎֑:rXGa9UZp#a1p'caxđ0<ȁ y|@,EPEXT9G7dnZO_Z\iB \Dg $!b Ya0AV +L~~~~~~~~~~~~E_$E_$Y催rAV \U.*d nnnnnnnnnnnn1ޭťt{%'v->+\K啕\ 't^@|?=OtuϨ_0e|-cis.4@ 4hE#/yȋF^4hE#/yȋF^4hE#/yȋF^4hE#/yȋF'@htN 4:3B?#3B?#3B?#3B?#ď^4hEc/{؋h\h\h\h\h\h\h\h\h\h\h\‰>{;*E(OC:C:6_4~ϪEQ{G3(XO? *֠b*Qя~TCE*Pч>T}CE*Pч>T}CE*Pч>T}C:TC:TC:TC:TC:TC:TC:TC:TC%?*QɏJ~TGTATATATATATATATATATATA1B*ԣB= Q@TOvn=٭'dnnnnnnnnnnnnN=٩';dԓzSOvEofK ~siXC{Y;7 ] :Yawqu_2N&\KA ",ue[RB)r+w \VbҖk%4v:Ik$ɯi4i dwUfm]~tُ.e?G]~tُ.e?G]~tُ.e?G],SL2,SL2˼JJJJJJJJPC%;TC%;TC%;TC%;TC%;TC%;TC%;TC%;TC%;TC%;TC%;TclʢMYB2+i\qei\qei\qei\qei\qei\qeWXƲ5lek,[cXƲ5lek,[cu[j7k,[c9:@,kai7{N1uG?RLy[y<.KD/Od}uEeٽ⛽sO};)u^˺{YwhzY_/e}UQ[-Qڐ]}m=Φh'jI7]zUJ3\/tҵtk'];IF6ҵtmk#]HF6ҵtmk#]HF6ҵtmk#]HF6æzTaS=lMwҽt{';INwҽt{';INwҽt{';Iκ:G` CѨԋ*ΗajjyڡSBs,rнǧ-kF_r+Vڱٞ;/C>\ZhK捶qn:ݩ=BGA-6ŧ|4sʹ!F~xyhˍ8q2йB^;]r:jQ}.*Pq`k)E ` )XO )C P@"`Rz=z(6@PjRT(G>JQR}TSHJPjRޗz.\0|js09T澿Sp|QK+dUϊI//cyXo7#n1BzFOƗKgc/}+zOW}rm1:Oi!/W}MOoO6TY.Ͳv rz+Xk>UUׄͬc3267XVU`;XbC,0Xf;kg>i3mǍ.Šܒ&>} ;=/~3'6V^%XZ^ͮZđBn-sFuMLdI>)6Q"P_S?U<%5ʬ'(q(1X'v.j6Mn?D~   ((1)1mnjnjmn$SlRIh+s&:{r|36+0> v~<ƈPt>n'l3p?fyQcGDEEy}8F;Džw~DYk46/^=߆ğp<g)'Y[Tg|u_>C_u7ѡ97=da%X4V2-7? ܈Q[p+ng>ϙALJ#x_e)ǝ?p.:Wie)߅[b-z)s}宯F^]kJ4{V Vk[:!zi܆+Nss\c96{0ׅBa 6ۆ^l롰4 ~l.D쮞ai}cM/J%:!zdsz8qv}d(P.#nh5V4Z?%4i7Du7f;<HuHuHu(0M:~2c7 V^3܄Q}ofdU"~|L6[7KO'l[>'yv-j7;].gr6[fkFmunv]mdW*}y 5Gd]u}md_7yt=#xj/!1|+a/!V>gyikEyDMz6]iO}賉5bͻh@cCwerZRg;} <67DﲲζXYu[YU5%+k&avMfdv;̮ɬv36n36flͦl̢vGGiH댴H[EJl~5hFk6ZL>Zu}F0#o1Z}Fb-Fo6z?ܢG ^[F7bXH]+V#n]zҾtJ|Qa:JogXǚ}sV5]5\PӖ):P&M#Y36 Ld=zo7A-YjC>:n:V3gsx^_GwGXx,?Z箲$:vsjN[}kym3m{{qwqokqckt/?XwD<4ᨚKuV?=>V¨بS4GewDYcpݡإNׯuF_~ؼ7i֤/XcSi;"H%3(5^WԚEYibmgQpl,Q;d}5nָ6֨֨QMv/h86̲{]nGPmF "fC631w8=nvYaۨF6*Qmn3RۨF6QWe?QJܭRŪζ;댎va'$)eArpw%5K:~H+t%nPTv%5"Qn۠6Rwl2۠#JjDieh\L9R׽i>j*#dxHPnwF0zTj9\*+7ɟ>\|+⬲~CpqX[y[ mhYY[Y^}w;;scFb-Ɵo mhաu^pSZowvQD^ RZJ{jULozUe؁v }A_GVnUOy^uӭVtnU3ݪnJ[U*nEj;ʘoÈCFa]F{hExu:s\Ν;QSt:iKO|brwZyֻúQTZ:(AӾ:(AjtPF5:(A*tP Teq5m֘VklVjZUUYRUeʲbj-*ɒuZGuj:(͈. Epex86Mď1 )̈6c ܳ+mUU'$AT|i(>o 3Ip6§8s8?r`¬h<~qsY\<5eso +o͸b:nw.܍{=G\@ڰ'tc'Ako42,8ǃi:?x?[ƿyXQ^0= 2|?3|=3W3_v o0?}Wa<51oehQFi~旎;.2t!C_{=מkW3[Q6wn~idPzwr~8=KD6>Od6>ach'\Ʋ|,;F?p=n ܈p3EŦp֎^kGﲣs\;:׎εs/H $:ɮNf<0/(fW_c.xX)4wauCSQyab3gqaZjL,}\.S}6fJێWx|h%zWDxSoVlYm ǭAWEVǏp5\1&a20V+^^_݊ƦOr<F)c0Q(~L?&ŏcL-[JV3{pދSqAӮiIq+0p;u!GI'p6s9wGK.X?+pe-^.^.^.^.^.#####fEӬhMiV4͊Y4+fEӬ.˻n.˻Qx cQt{ȿȿȿȿȿȿDqS/ۅne 6b;½"}>Gd#'D Q}/ j/ j/ j/ j/ j/ j/ j/ j/ j/ jBQUC^&Dy(/eL2Q^&Dy(/eL2Q^&Dy(/eL2Q^&%KKKKKzD^A/P([Մx=b9Y,'RW;ff gorޑRcCYf;Sf#)ыO OƋKs~}zkt,Wx?2]LwoL\*\d,r\Nr9Y.'d,r*J.K*J.K*J.K*R!p?fƒx(#s#sjw5dѬ,EhVʢYY4+feѬ,EhV3ufLԙ:3Qg&D3ufLԙI@(W oOd 22s^f+ + .K(295CS(225TcN292zNP<$ )QN(:(9?(,#nqΏX( Q>T(Q!tEGQQyuEGQpRå*KhZM+qƇѪѪU"TyD>/2J/iTРȧF8*#z%z%*~x~!sF7 }A/H]2G_ 8ʸ?r[8L$˼S< Xޡ]CɪpzDdntMÿ*zD?'D ʪW$* *"[$zDo-EBBBB[&XjWtiijijijijij)/ z^/ z^/ z^/ z^/ +ʫ򪮼+ʫ򪮼+ʫ򪮼+ʫ򪮼+_as>jOǷ=;/w=.uw0ThyZ^3]{%y8BaDRGXۈCÈClKaS*. .ׄrv&ϕ4/˩r*/˩r*/˩r*/˩r*/˩r*/˩r*/˩r*/UwHtkdU}_k-D$ZW§§gÜp~16p+,#~kkݺ艰*ZVyY~c~W5:[E7+J8(ge|$,⹽P[^_:#[BO7tF/G0;n6'|*|'nO mzuw~]\{=1^wqgх>qO?ێ$ݲgR8:oaFjCԀ<2?>%*^dSFZUzwtﵢL=q_uVUr}kZTE5H#Z@uȡa8: 4,p=n ܈p3n=ZR*F5jF,Pp C0 0(G}88B|_—1 1S1?Oq~q~ºq]ް. uƅ/B1uc(ؕ2;{-e6y6VsoW<#B&޵w0޽-[{;^C8foWu:|:2յ{GmΆtu\8wUXT=?ոp-&ǘɘ_G1s<OB<W/³X%X<^x /cVխc5`- X"ЎaA͞(kASЖa}pn_ym=iI[Oz][ЀgK`isO7zuVuڰ.]^'b;`Xºx8-e>qaA L4܎Hh<8Ԟמj?! y~3\c&nD֏8БW#ޅ#C[;\߳=߳=߳={ ntށ;q=3pLz9:!^]@ 5*t=꜍nNR/\^8>ܗ}}^ O1xobqk:{tFGgk>Osg?*[irlY⭕G:;k;C{9T_oFpm#kE)*:_>Sre-7 9[첨ng+PUgʽs{%!:XV`EP"b(P&"Ų*"JQAW*.P@UTVHBI3%&$X}s9ww{ <\.ÅbPb{$:`'i6_c^"RK?cp pCRK-:zK-wK-_1BI<7o nwNf OgS<[LjzJt@Qt6:cHib,5"-]3j"S#VGQNSf_JEI{LpM~3w] [WcV~V\\O(HH@ʽHIb%6b޽ ]b-C .G.43b'^Bυ 9:r.t\ȹ}sQf{|砧(Km΢E 3Ez?sUBهk>ʡ#BiY@-:xwb(@m)r# 섙|7ވK.rf#g.rK5AHki Vcp9ppǁܡN@Ut]ݧ7鯧At12bܶͯ-[2}.Zα4-4wZ#\MۄpipSe", gGG9x[le :.~@4@ 9uLA*LC{}XK} UazMȷ2GJz? w\~{g$ӤNlCMg/w.-;nO^p=?Dh(50?)ڂd8uClu/倿ӛ5堲T8@0䁊4fD/倿r_ˡ;H7Zpá(1%rP7Pӟ9rz@3^\B!e JNrdjэ&}m '{8ßrãrm[ܡ3jtn4Ub4U"ދM 3[{m& o+dg^f"$S6Зjϼ"ܹztaGdHg!BK!Aw8rP+ry2@.!ryH3oJɃvAH\4 ~"\^@6lS>AS ӿ(9(Eq:0tM"oRdYWQ+P+ueu@T W EzHWRCj)|K1MLfc0XBXuk]"@soNj۠ܮga1S]SoS@ZiC>.粯g.XhQs8Qmt;B\2F2}@,q CpNN&Q(Ϫ*+ΧF֖Y;v+meX'źźS&{?p8 8-b5x#ބ]Xޜ7g%_[K5v)a-ko淰+m֚wٵ+ʮzރ`mav#yv;z|,_o|*7?|WtwOy&f09l.ׂ7 J|+"A$"Q%V:.[%ꋆl8O֋ lh,MhDsq)*ZYh%ZJq%)Zlh+ڱVq=,KX-$ACX1{b΃3b&ŗ[ J$.^Kd ϓdl[o/mr?(sX\ߒʭ|.5 :A;>ʼnsBg/q9*'Im6]>9!0u]Nw;]qó87n%$nM"^^(׊n;>-wEWw;RvLj{Ľ8wϝN=)}}G=Mzeo7X>==-x{/'r7)xcSXMO9̛Mýtw;(GxCewD 䨀 H9&AJTɁd9%P%P]NR?;݂促݃'O{3_/P9;|C9/uG5U(!єrҭ9;QEyYo{/(8eFW_zO?EJNL08)'nO|T/J" DDB6l5jkuF`6]]0gt,,,#8 ĄScfOaf%CbBGLISNEA\+O.izW jK(DqrH ̪W:̮SX:d&e~8kA:L:tS]ʃDVYJ[!=)\V.!)o"7Se(C^Zyb5k%+)V^+r5US㊃*Avh|Jq*NTOt4ׇ4w.t}+ r+qMf+˽2C2baK5qH]+5W_J5+ WQjZSH]&Apn@H!7I-y/'OnBޛ[ 313:SꢺP]El/bE!WO(MFHՇ?(?BO{A#{̬ 0^DH5!(F#+j,BƩqu:B?)h'LPk)j LUSrtH}zX}\} >gYj6V߫DA2rT+P[6RڤQ'[vCZjڍܣR2Q>upP1W_], ,&Z Zlq0`>efX\{^>zڗu8Na-Jq5(((c11滩xq~b- )$<"HDсM6},]Dwofq[CU p00<`_.-XK4W+{TWkq~n¢k-ISbM[-ު#8i-Ѣ[Т[ Эnu7{^u/=T\yQ"ε;PD| VoγH',5^R/#ĠgQϏ5<})E=(MR&Vo#Aaq0 pp웣[W}o*YKW٢^Edz)|uPD.},D/',Z@Pp()|*B>KS<4&q8 `M?@_,$Y?J߇oA4Md|H//S9[voVB)^Af|m7*Z۾v:te? il w̬uEҝj_;83|S ҨdP=р,Ό+ɒ)m; A/?eYѾ|G;; yPOѽ f_.a_~W|ב̞kНk<˚Sc@y\7bXJⱼj)lGb}wEF~ctK7R-[OƇmSp腶(a Sb4. GH왏oCݯ̟[l=KgJ:NsO p*>z}_3Dޱ>5˟Nԗw24~8 'P;D,8S'"g1h?4]4:h]vnm>R._wl|zed&nm;"s"rg}Gf7Q_XXJw[Prp{ֽzۺŇ0z1f=@dt=)RrtH9f^2s/,Ehĝ, *:Jq@3Mo\+Qt׾tN{8jV!KO:gM-Qx`=NwAʝgί~K}yS&:E拇gpsϬKQM3a$#t`ius}%\V9܅riUbphr}W3ۻ?к[dFg#/ѵMc3(+2L=#~i 7\4lzYawE1-6>M(f-] M@StIUrឋլ?m})2H<{] "a,3緌%f~Q0=poW<"C̿b; +|ʼ)Q#%: :0:㙫}68)(av{gJ+%3qO9{f=YgfπH#=i/;E}p4e/>D1'9EZoV"pdE`/8x*خ&S/r^_t;~,Mtu][R#˾D/]\nC'fP#{^N8=,^Re AcQ Y35kUU#pGPS)8kwb>,L8jhr2;J-js~|]/R[ |{7﵊qejlviʣ]=;k h\w^^xSHjw%[po|=흾z$emr)yU+3[,wߡE!xQb^yaҺȽFWOgZ}#~ĺTsݤM>mesZsDv i뺛~L'X62R1O^+iW9xBwq{wdȬ`>qUzoHw#_oBVz{bn^)B{}~x8j{;wr0YyMsYt69=mX} WeXI(x Z>5}C]ѻ:0,Mj?AT/,{?x)+G٧BKBNgH[*5jnŬcMПrPs%/=בq=wFtO; 9z ƹ Bwk:2 wT/z}[؝6Gs9ϵNQ2_\/et"oVtډkc ?{0W;lG9!"F{ԏ7|=-n>cG%hˌȗ3U֬q:^e(=M<f`Jw6?|䊥=رc4]8Dݭu:0kn8:({^v^cpz`hNGu:mcb߰E47i!oʛbc%-3h97Ck8+OS)ǧS:g.%9|./ /,/l/#|_AG/tLĉx5H[ sd-9Ô0Yr!L4cakU.ZV=Dѕ%oXR7'9Se7v5}NSpdq9Yc2`c1ؓ{9獍7ol&olƦolol}483ݸ4ݸcqeqϝN1Ʈ7vxEc׍W5vxmc׍wxCcэ_b,n_f,+E7Xt7nAcэ?nCs=şB^?zq/KzI^2ΫUü^-_4cq{hcw1v+k]kcw7v[h|z}?5?04>y#Qcc}bO5g{zsko)[Z[e m*?GU6k*`@u6D@@87'Q%$D\P. \*jZyk׉7ڈFvIÁ`jXwWnzcM`G6&2 [Ci=1Xkʏ?;mbѿ_3vD&&&N ;m&;m&S6y?՟&3vdScM67vdKcM2vNi7;mfcModceMv2VdgceMm5&{O>~11 r&9sXX&gi@h|G*qXRnz]é>FAJ<4p 11c!8+7;bZQw`ޘ9y%TǙHiJ M,RUX0|`n}4`kA\'[,n ,nM@䫭dr.B`<5e0|H]H=Q5j7آvcڍ{>ƃt)D-,syS\/,sq,_e1[L LjTO|:PEZSsp X_b}Հ _~u-TW,7_DdLBH?Fj>DCx@^*.El HW1Z_k~_}:M5'I<1(Vc9NNr5d,ߖd9]~N)QfRcMq.3 f\5Ή+ NjlFje gR uV:+I:`Yzlp6r6:s69L!3&Q،IHNȴك:TfBCd;9oG#sc1s9(;{99"b! !H%h !JZ 0 0 03 p/5kXc5Xk^kk^c>׼kK^>fϗ_uqM \fs1V8=beyK<%p+,6T*(Uw> fo&Y|Ka̜sH@}s1c1y8/'l /䅨3"ʟŘi4-% ƔR;dXqqsWJ|?x59|.F:/pί/ẚ+܈V1wjn=lwpV9|d>q~Z11Q@l Vx|5)8M#|eoq<Y_noXȀxfx);b]Gغ??A}/߇?1 b #3P1r|'?1popΧi--{g/{1c ]W0?b_177m~MfcROOdet$6Mlat ( V/?^gE"T?fK%3Y/ŘZw}=WX*}±DF0+3ALP03ALP0Ħ fS3*LlȪey9r9@NpEY&;^Ea_P( AC0 * .ɫU \f֢O<"DZ[˂Pi$AZPiA$ ߐo(y@]DPɟ{+D*Mr̞M$1)1 }%17qBV811IXUbFbPClV)OMS<0$Cl3AvPlAvPlAvPKl^۽&$OxI io$¤E,C*K63){Id,@Vn$APP ʗbe1|E ,QGb`)Fr%(J;fŌł1VŊ1]J6)vŎ1=c[YU/~RT {T )a(*82MTV(+13GY~CY1kq#o+z|snP6`;; e=)ȕ\7Ze)0==l@S!+Rv)Gnl*?U3gw]/CqߔKW~ #*GqʯQUNbN0?V91gs9{<+2P0{B2+YvJ$%rSSpXQWSpRV`|-kHF7XiTӬH4<$P4<2OR]5tD$ωYq*q*Jd\Od@dNd> T:)D7G)awAKCEQJ@vˡd<IFҟ苔S."ˡģM=O%G~J还9aZB6?/&/I(L(D(LL6N9+*S _(&?LB@q /`~ NN`9 , P_RX:&4"  l㬆L&e2Q&$dj"'@N`3B~~#uRDKOPω7gO݄ #ӧKDzDuz"t"DuzL:8|//sbtbq /e_1^xQxzbzbbtby֓[g[O%zW`ʯ&=W1W|-ꂘ%b7H|XXy,oǿJF,^ˉ_%ž?+O#V V xDӈ+g%*9DDɳ%?d,ʯ"5~ 2"22`jb9G"Z"7_$Cqp-q4s砂_п9EXe(K,R(ELG)bI"H)b:J8QXB)b(ERIJ(E,Rt"1QؤR(E,R(E,Rt"F)bRt"F)b:JD)bY"4Jz ELG)bi"D)b:=K05=4Q~X(?LGai)?Da_F{Ú(?,t 5R~Xa:ˢ0<$V 8CF~B~ޠ@.ϐg H~ ~X.FD.-r<%R.Paj105r^~͓1r#{V~Nf$7!!Tـi[W{e7{QQ s*Lrr8UJy%TsoxJ)'3K~G~wwqtvj!@ކ%/1;?I m<-9}!!Klv)SR܎g\03<`+C9Jzԫ?:ﯭh u7 =*=U=е=9=yM=Cbb֞@KMC\^0tθ~wO95`]r{㾞 nl:#x_O9b|CgYuQ itjɁ3^þ;Gj4x/+{CYlWUqw;+jwPm STR?c,4k` :}4j{FY=Y4pZ:pZ1VڵsOh/ixa=IU;|vƨ?ˆ.B bWb͝v_6:5UQFuPa}竃}U23^lua=W]5>g\ M}KHM#Nn;}a߲}+buk!ߚC4ێQ: 2|p^O=5wtzpެ4\/Tte޼Qٗ }-yMIrֱt5t#Ыێm{EWPֱ'ppީ^12Cޚ@:4qH.Nݣ2rQߚ8H5*vzq?c2%h*qC+ 2ɘi_[ͽZޤḻ .!5N52Z;{'f2y;z2R1~5[ʲ޺%c}] ue<@ľQ=)4pu]c} o]{MBQǵʾ=0Xc߅s Nׁ;#[zzRXoo='ýˠzWBG{@Oл%prszwAk쇡c8k{7Re8>(m{UԃmXpqtMT~pqQ/*F]W\/|oK  -t2hžfl~9PVTIZ~-`oj:3k3'dTw yP$-$fvO6jrY:+xX6٨E+ۖ;Uib VrN|_umNmrzջm[*t3\ض۹sĹ҃M#έ&Zq.u*X}ējW`j̄?oyy&Bxj,Ϝr($1m*<= ֨g?vܹ#hj;l;tw z.: k<>tdЏ1g0|0vy1$9WdS5<]Ɣ'יF¾T4/#PЗn(GME}E]Ҿ8o**Lf 6Ļnj[@6jZwZZ}C4ҷ-Mvf1Ҡ3tӴo(=Nn}FM;;NjwbrKVߩ;}gqtkáKУ}W<Ӊ`m}q>AϺ[$?4]rM;1]ue?ۡtH\=`Qixߵ .l\^0 x_ĵ}p|kɜھ53uus".ot] h޾u't}u4lq[ x{ݙ;'~̝j Oo?. ]Vs_/EUkbmVu]h8ݺ23pŽ(jn` YhV6]s0gU;*/7*km%BpĽ;*6p\އy `7 :^l>n5/r[Fɰ]ܷ3>gx8%qj Jx58fb@2{WY4"$u_Aւ6o3/wߊsEx*UX/O׵ͼ#{d"Ǽɓ}nd[=Y@ͻ=U>|ȼS(5BQG刧"ʇ>':>E:Bz|3k7V+5%OC|YUѳ8Uw抧5Pajͷ<@ǥ^H_vi>9mr ·zF4k٠-6cغrܵfPuXvܮ-6Uwm\+0ܤ]ƊuĊOux`dYױ#㱺;0<:=x&6oW®˃.^ǖt]6b&˱NO9lǖϊm9p܁v6N<-_[wyBT)<ʮ[6Vouv&k/mşٸǴՓl$ѷPJF)qcwaE~_lgĶ8+M6zvT޸EclbĎVwSYFIO`Հz O Wz~\&x.m7vͶt॥lN½.㊳ZvO,U}t>)u,+ívV'1`zC?Wmw [-7\7v:$6Es]g4bS|&itgRdi4HIY%Mc\16I*dIߑæ$'2uuXΩcٺ_~rR?{$uzԦŬ1Ր:̾VY8hUki͗TD6%LM}dQ}b7&VhRg4CF,~oR3EHcdk:41Mff^3u͏5|95Kkڰf@LƯ}K&}[-MH]MTCSUO5+?\JK4ocў~y[{^;Ofڿi+~NY7I7I}G{\4 M$/?+5|_䵒/JKlnNi:wsUzzio_NH|Pz'^>HN~~E%_M)o{2=ӧHoI럕vmA}~tUM7 );&W5a' }_$JF&LV)B'_MCꧩj2r_o2Z˷߶Yk_>][b\6_-hښV.Kk[1c[=a6b`lf9/wn->UZ|ƯgLLaMT&'4ضS!KUWDү_3,QH:Œ{Uy̙aDcFƈcD ƔFJc? EJi ̙gL?ȣ\䦔@RQRcDbiE."(",E. w΄!J׽oVΗ|g033Cی4Qۍ6?Yk2 }kdPS)_ej* IѻM%qVhg'{MM_Vp|f~C.fY}БЩPOb*BU:DUp4ԣRǪ jR3USU5UեjZ]nZԭMݣv]!h'9|Wư5KlpAjG\'Զ,\Pd$\L 7j 7y%esDxexMx}xpG$&1D#,HGH1d"UT'r;EbHr)3"@'"o\w-'IPXpX`.RC2H#QGaa'[7/3c($g, ߏx<eXXWȚM>DXs-ئ~5O1tO50_>e}JLδOY _;gaRZ!4 Cl]9PES \'ݡ@Jel2>6!tzpR&c(+t(ScӔk࿕Y1wJ̭'9ShcQT%\P<"ޭ/(c Ej5%)TTǯu IYkVV+kc)cS_ƺ!Qm#9֢6|:%Uۡ+֖ћewle_f^tƺCH(#*707Sع;ψ*X MoV.Ǯ0B"n,q+#Nocc$rBCPn;^̺dL"7݉tvK(Gk1 J_x=GБ "j),%X+d?[="w0xwǚ}{$ޘW^Gd}c0kcnyۭ/f8I OE=ŏpO6|1B=0%GOiɱ(bI?"lp ؤ֋_7V?/ܤ<24]"xdxr.;R\\1D&F%qݧ_ z6z1~o<3{}Bg,8o@C\P>>p.A.J5|jnƹWv9W&ʱsroEf&WWL%7Fd ǢLH<:27܆}ǥɎHs CuɣllLiI}H!!Dڒ#~q#eı+e Dh*/r"UNkΥFDΧ"r{23h4G5UqmƼԔƂƢT=ǢƲT<iH%yrƪԼBǍu%xfqJjYƆ@j?'4&Sxvrƅ%R9͍+Sפc<R'ghw.\{tM]X޸?-5HnhqzV$-GG17:&VX?hMzQԑns@frtjz9H:a[A;+To;[-VxIjow toܫm+x#ޤwwwwwwwwջmrNo޽^.+c<]NzxW}o/Ǘ+F*}}5^cF777k'_ڥCs|?翭l{{P'd;4A?{|S$xz7ކރ"oCxz?ކ>%x ކmCxZF>%F$mh9ކmXI%މ~Dwx2މ~Ph(x'މD;Ix'ZwvumxF OT*މ>#fx𲘉w;oli]/6HL~!|Y?D lC#\\C\y\ɪ HKfyN([!Ry=m4Y[C '\dOlyW$Gv5,Wn0V(rhc]Ê76XhEĐ-[ h˰cG#vQ`k"ϓzFyfD˄"/z\<L-U_7׷سڷT?_O%[ jN |}-ro/wͷA3W&WSV|]C(  Qb Y ϒ4\M>;<?_Fs*?mfk-!kTIX\_G#әr )qo眿U=FxlvgYh<T4+FJQEQw+yN@)b&RF(eJEPB9rR4i ۴AtqeȂI!γZ٪LtFjF9Si^iVJ@(IDA=)󂈬!ei-)˔IY9hF|^YlRZm|"^\]9]Y&+{'Nl;l?xS;9&!*xP惡 W/z\)@qs:ol Dvs37P( T˾<rE&L"YJF#t? 'Qj3@:0_., 4Vyfϡ.MZm}NQ|"pd  .RHsZ^ų48M.f(]SFR,$lCpcplp\p+XtgA_VƃsrR9l n ,xedS 3 TC>o2aQ7l#InI;$Pw ם$9CB&gXeL2&ex +bn˭xr׆v9xfO+9'1s1vбS;j7knuutB إ^C>B8.I#7t<㔎&ЎukCx#ZxQNz aaRn? PH>Jco.I>\G4Lr$f$Ek;I1Wvt!"Ẩhֱ6~7`m!t ~8ts;Cǣnǀsu݄ z7sਮ*{ovWx}mrc>a^W6m{ aCkбq$ԍ rBo3Rcv/ا;^W}hFκO}1%;d|X-326?yh?eBj1|d_Dh⫛׋}a7fvL|Ӟf߮׾KuNqNsg>YY}~kOfSYLzB_8N֨oOɬS7:r9f]Y ޮ}Pے]|p_>dڷ_WB{a,c~}}⇃$A>|mOgq-9~A&.msOi_V?ė>jX_׮G{7MZ'9x:$Aud<@<;gOuOq2;VgȬxEz m8FO&\s^oi&VT8/)7rqt2b-9yy`rx_9?ڣ'ɤILv3M&;:&/g&^nsLGKׁ>.%?}9L&8Y#ܜuR}aX;Fj}6fk%ahGpF*=qMGQU?CMQs;ʏ9v;z8،6cG< Q(KWP rEfs=DK.6]@mA[;Z<"^ Ts'tl;63w(?>j/6#yG?CyC]OQ΃';7JoO]l3j|;㸍e6ԁ*Ʉ)noxZPND})g{/R#tʗnkTs'),Xmg^Cl*0\)gE3>~^5| n7{{V-o486[M`N܇Ps5 PA[w.=`n? -*Gl(?oFYi7{4=&XQw!]Np+ V`6mLkG?g./`X4܉'t~6m5W*4\S8{ 56bryl  K8X[(@9=j:Xofjf7m-4y}Bs3x~-E6'OtQln0٣.fZgUxbLb|T$QcCy"w:9,|5`y"Vh/Q'| я-|)sQ݇kpWG*+φs"}Mngm,}#xbhol`\&QjxD٠a<ڍ>qlf* \u!lS03k{z>D3Y=2 OqU 8+mDžr c<cTp eY@??ҹ}j~ʫt>n)L4rP -#-vB.R㲴2K _&Oǽ,q3S(f?Ƴji_?޾;yܬ?MU{3d/+exhYowg\c2aL?;ɷX.\^Z_.k.r,+Xh\2l֏Ϟʹʦ#S9}Gr+P""SnypyQ-_MM& ~..]Q^~ѵ{?s&=,] nY~2OB!,_'֞hzYVp5 -⪗kpyEfGYgRd+Z8J!Qu n7IA~&yӜOW m0Owap`1ӛ` }{ N2iYx/{&8XBOo2;-g(GC_>AT#7s7 ߙ=opLo,[z"jvoc/{S=\{kMHN""咄T&!]B*J%!I%n:[[$!:SR]x=?ϧO51k1Yy2S8׬wgքښќ+ M^-K^C[ wߏ~7/w۟9K|5+f7ڥ3J<־Lq|׾FfZv ~{Gr=ubF@Y/:Kzx0ᘤzhԍLA?SR#'|ex0Lw:1TMi>9g=婲ڶq׶|/q(źWxkQ*^?Uz"|ۗ};y\.qߍ=fvD+0Λ?U4yޛۻc>xoK}ws%dB3~]QPe8#Oqѐhx&c),V;@bQ]Fwn@nwv.s)#Aa G#τp~ʓznNs޳qPcXިѻ&Sň@K>E^F=#|A>Ȥ*r6I[U띻LCħw1ΰ%3uZWg]D(C^ȝDN$;Xߊ1p5C3,qWE5a4[L 5e/_u܅WMO,xYoUohSoKїse>evBWh5꽧?g|Va>UxzN565ZL9qhjEr],Z鳯SۊJV:*_yφ*#+[,[!GN!aqU3d,nVvt7 /Jѓ&C"Rx8HQ9ZZG&YglF{8C頄z px*5$ ղ5ޚD>UUR1ZFgfD0|FB)p3or)" Dbۂ x-IT+zJv뷬U%e+}~-$b9 Y>E Gw ̏3̤| /C >L%4Y ,Ylt'W`-6 fQjfp]Q øVTOÁ^d=_IϣY#_;:aO1]k "D \W>bxB&~5Q:\֥-c:B_s%7>f2;z ߇7;*Ξ&72Tr[˥d rpjyq]eSsȨ~* ORW[S3&<fjx:܎J2ފ p6sS9I]%24@Ӏ5C_8,Mb"zM\wz\Ʃu)-Icԛ2;v~;.9ųJ-翫 UMYt ȇmܫ򙗾?>; Ce/<٨—D/yKRWse4g)X-{CvImMW;X'aI]q{F̮TH [iٝxV{٤ TY(gGtiO(<;89fջ\7:2NYjd۫VɥWu+o'ۙm>Ӧ>j-d$t;T {DamFI`&PFGWo1 Ѫ@|7f[mm8Ϫ,1i5͋U6=tۨ}0S;y]G3b;urpK+9x;Y0^6LqYX)IyMcSH{YְR*Cs]oJh4Sckj ò~^zj>ukN)^ Luf$/(Ʀj;z k.,)7Oy,rt/z5',IH[<Ց"-2W|;,Kѿ OyaG(I #h*bs2ʰe wr8eFi ,##a4ehMCZ?DxRLsh]:OZxzfdO7cYy_8+ xFXCi9X^gOxuTe9|yFhWJe{ x21IWpeѼ.r<LJ_1Q&G83aHId]4 ~:3m}9<1ǔ'ߍ\FX9:e\YqZlmYCl,u^Һjo?ϮᇑG%L ;+뱉t1wB"iKpƻ @CՀ}AG):ZxWlqUAY 7EDq3ZM짢Wvv$d̖jxT{ BV?`p܆5?ꄞ J!øCWմ?E؛!9o'@r/cZG\M f5Rl=0_>[1^ӜIB Z\~̳=GU_k tRFa5Gۏ=`s-9oiFYgzo8jm>Ei<<وO!<샃l枭4#@{}BbVԢ6rmUy9OD5ӎ^MyBR_59T/<3y<L?ϩoڋAmF+;y)6,!g"קzES$櫴_MzU]h֒'h}eѿreZSȷ#?Ax Q9.τhސۑl q/!4''ceIGk28V^yVi&!wAf(ZZ{WYu$мf mNC32]=/K\z2MWr!r":Nz`?&=dN{YjI<%'ȫnzMoȺPlӷ_jǵIJ_S++2fҚˬ0ߝQxMYa2*7/e䣘K.Ҽo))}LV˧g~MB;IR /zդooY;7=Hrȵ{]z~m1fW!CQe+wm@g.r߷YԿ#ѿsO_ssAozdܧr*G_8SwAmZXvwotlvcN=L^|}Y3jp?MBR,pѯgM4L9A؏ 87Ʋ }ղ:ru䚩#WO/Hn@|~*33%LZoF3ooR<@\K^\ ו&c*OcGielW#yqƫȯsxlބO_ PÏVSM?IO8k{!m=T#k#`.jZ%}O1SӐw-h%N}[7pD c2zOޒs{wޝk$WE~lII)PH5DRn[r']KC}Aɐ󥬜#K辰\-Vv2LFK ÿ1qkF9ɑr\&M|uIn#~.w2XJ1-ڴi.-]{Mti\s\{! i&HGX,e[G,ɕ WKSi-UaťRR*z4+\+7Kg?z!G=2>rP[UBH'"Td<(=P-Ӯ5t7[aûvg8 .t<]p3wuڧ(C "X[;n`n}vna=wSpeqp-7{<(}WQX}c, :lߥ~Z#{w7T?NOp& k- n[ѷG% ~#Ā>]94kPFl [Y3ap4'yJM<.+=kMp wýv: 30߀X"X3G2.l–qkOοp~'3#U4C2cB^rޙ,i};\wW"1ޫi^]oٿ_,H-WZ)Rt.ק2B)/I+??I~kwy?IfBY)e '(nA^0: + Mi 53,2vלlI[ַ-mG;A=Wfz$#O=s:h˟aםx}|n?ugns!Ԍ_rrگ^Wxm|}(ϰBX1ysU=9Nuɱarl۟>Ne:>q*ԬygxMgN]ȯ urx]t:ux}f{3^:uW^KO#5xRzS]w$ \+H*[ܭt I??y C!1X5]Mc^1EFxlA߳]ߍZvɉ Ǐ!ӏ*'<[d_穳+kr[yĚ~Ls\)_q"ƿm\ZRʸ]~}_9v_ ke;&ܓX~X}W3Vִ\KK_up=#޲MlHmvon6}T쫲/w%ǴGʊ^&E(PPHF%e$cIz}d O`rLXpL~ ~IIe+ݶJnl+{=F؋}>[=7^ƹq{=bkc{=nkInrOKd7qS{ںnnnf27ͲK%{7Ͷ76r<{[umto+[-Խ޶Wwݻ*-26wm t*{[VC}>c{}b۸Oݧ}f۹:m {v__'&ww쎹m'_B  _|_="g,>0%MI4eL2ME)`vV%"QzD=E=R(Q^'gGAR\9Ǖqe/JQWޕb(ʮwIIWUwkI)wDwKe2uw \#W+R˺fs[JuvwTr]oRs"I57đp7\nphrI-7֍n/GݣRMtR{B'ݓR=힖\uz=M߻s=F\^t/Jc{YW+rJS7͗+k5ʽސfn[(ݟܟ{ǽ#-"HvKRiEΕr[g[Wvn׹ڶw}mUWkMnftt;N߈r;ʭ;,(Ͻ@jSk+܊[[{]m1SSb3f6u?}7}I$*뻭Ԏs?cA˿/1Ua)%v/߇wq"3e!dM]rȿ dg5 +/ru/YM"YID>O"%$"_$ٞDdG+_&sIdDfW&:$"$ٓD$"&"LߌID&!ȏID~J"?ȁ$"J"r8$"ǒDx%%$"\ɏ#S@0qd $2}D9NiR3#:JDm}gׁٔ[$ *_ϛaI;ok Q 30+,fC +s}Ld|[)n_<]iWv]k?GvE\wv:#?W[v]jr]a?GkKl;[iyZ_?u꽚C`$f7f4|Y(hy@daϿ.L~?!IyJT&9! ̒%yYf+̕y2_ȫÛPޒ?kbY"Ke'}_9>JVY+:򑬗e|"S_U>lM5f|)%k-V}A~drWrD1Y"'唤%ߧq`ښv:\on07&l:[̭6t1]M70iz>3wfl7;PU$ݺUէO4H$FR`&P J1'Ĝ0 nj0:fǀYQ0+( ww87]]}ӻ}OMr&KyH !O3 $h>j 545Eb^!mD&ԏ646i ڒ4mh0mKH;δ J44CJ4Mо48Oڟ&t D!t(tIG$:&1t,G t"D')t*Ft&΢:ΣEt1]Be4.+JnfnhNwНtݭL}t?=@C0͠Gh&=J͢')zг=OEz^WUz^&Eolzޥ}>cЧͥy9}A_W5-GZH?ϴt]Kt}Cw= C0a0B)B0F+Ƌq8JLGq8^ N')Tq8]!SEbqT\&JqZ\#׉FqE*nqK<$3#bxT<&O_ij9xA(^/Wk]P|,+V|'Q,?Eb$,4/iHz,=r3)WʓK/+Fz+KRA(JRTGz'zNzuz^z#}Do7ӛ-z+Foӗz'}}E"bR2}~~~~~~~~[}fsl}YF \3\K\g uBІx.Y,t[-@?dc[Onpt!DWS#6OxF؃ͱ{jj'T^9o#L" P@<٬{o_h KT00@+q'Ykkk4Fو'`u$73>{ZH|Zz$^W7>-ނ1sbzF\=l3;5:& P#FHX#e+v !ےjZ?8@@ H+ /p>¯#C==b3i0@ 9f`hi:Ɏ*:`cD G~C;ߥQ{0wwc)ˀq|mW$1d$%T2% R*+YI֒d+I${A*/9JNRTI,UmoeYſl$ē _ox, ?eKlow,}o@V`3Hepedp[+89㞸'q4}p P䃇㹨1NKPw Ca$$d (2M$c4L"L2BsB2@g9RN2Δ3Ek8s*Z˹ph?5F_beoW4+4S _[,_`+#[kvvs p%mv v.nMڝv8nҞWWpwua>Hm1pdMk= gkk::_uu]._E5Hu!Lǿ B/|S-$;@a ~8g pH.ġ$TZ&#)$Fn8˞ݥ`Tipij(jXj&խ_-(]6ƻ`8gS9n4x^Bo_#W+|*̻+W%|_W5|o|?g8Wi4{.+>pB+Oi@a3k2l lh*.H/z&PT&HB͡ȨC u~1bzA1EQ"2CCPdFA) +l5Q+dcwǔavFlU</2<U#ӓ$TOSQU<D.0S+]'>Ϡjlɋ NH|$2k~@9 {C2J(@!&` 3P`P2`.4:Zlg@h/}38< C@@(\DZDW8eGJDE 0 2!CH QCuVB0 : c-X*JYD"-mA U͇,꿰%D߉f,!0CCx,Qt,8$8$8$8$8dC,8dC,+>Hğ =a1\ey\{⚸!nՅ8'x|k*^7x>Sɷ2,2͙Y0T[= .K$5B<| 64E"⋊ihn;N#n{ }: d$Hr)znI,_KeB\X!VAQp\8!d29Y#VN | OgH(!?q8O/.tqW'ěmxO| >O\R|-QI'H$JdPr\$WMrCI^Ru[!HRMT[#ՕIRCXj"K^ecD6 GZ5Ȋ,C,94LMj'BF'2 YVf^pi\2nnC&tm:2kA,\m!f,f&vׄ}ju2%V v1nͰ`mvcݞaw"@N uC d3@1^X߳?bXo"֛Y?Z~tb2ͽ歙mGPMny݆ȮыK|Py b1 k=efOCfO#f2̞̞&̞̞f̞̞̞̞e=nՋ\e_F:晟"様)a~}_7,JE#E6 '̓)d]I_ (C̉5q$U>{|~?Hv r%,%{>rM\W/7rw9B{1rO ȣ8y!O˿_e|]!gyKV~w=$8o"[HĽ7KSrWz̷h-g/"ל(8zuhIkҞt"]IĪxz#5ut|_|\UE]#ai⧮}W\մtx]/~T?+KߗJ(?*bPR~%s17mڀ۲|}$h& mg/:Ct]SZGbj.Xgβu*G@ОC{V޽2/w`+W^w`?0,'\bOЦD}jH &z>#961&6#жPjm27⤾0 v&v!.H}+݈&Ed^B@{)ה=5q\3D}NV|Ɇ|S|n>ڽշV`Q8~ hAd"A3ѯGXAY~>GǠ}*gp&YQِV.3 Aa_~;`Ap_bA0 q8f`A0 q8f3Rr1̘fL3&`D0c"1̘fL3&`D0c"1̘fL3&`D0c"1̘fL3&`D0c"1̘fL3&`D0c"1̘fL3&`D0c"1̘fL3&`D0c"1̘fL3&`D0c"1̘fL3&`D0c"1̘fL3&|}>ȷتg5e{<%v֠xzLIj5`!*ZYP\`MjZq)f][ΩQ FDSw*N1m>4K?Wl󋽆&[U5GdnC*G0!&2|wr|Wa|PZubɵhMH`3:31.H՝ԄSl=YqQB?rqmc"]Cc5P,ފRãFu/ΰSjS2I G%Bɖ]l^ 7 nUǫZcj5]</ cB6?T(82a`tx˗`S`@1F? oҵY[׽Ό)z7t~f;1_>y){ ó+.28qz aLdS{?a=gki[wpq6Dyf[u^Ѵ}ǁwqtIm]3vSmJ[hPqӪn4Y5ٕI Bs{5X~ZkmP瓶L]?%ir͍iܧǖa75~ː/:{3=yq;mhUp󓄃a2@-t l&VmE߆Kfps{|dQ̅l5yW6~B^;eVaU?PNRi6Mm2Q }b-<.=O=>!.b@xbofTȌNQ:ju0.ybi4Sn+d|/_0hР}AdrDD a5&J/|b5}FI#KM5|:mr+ac}ZH Y6g,Pڨh j4+b hZRML ?j}H;:l)x:Y8)6Om坳הe3:le)_%rKNkFOɮd vR]\ˌ1vpjMf656y4` St?'?I8zuL9ǭ/J@@5bl fve9Fw;9+sIt=n i`@b!jpWj(^J5zzj?GU|_oZYUq+{v |e+'翮Dž3z\9gmYUd؁I0_,x9L՜&,y˧a'>}j S>69gpjV|Xwvϫooae?Jk#=\ {ϜNxIYq;8Yp.=8&3fMTnV|LSSec.)AqHKke[7tfQv1]O囷-g#koW8٥m5 &auRF/(ͣg*%ʛ{o_i &vzjy=l6_,u;&nJP ((CRy j(gж +~JR_ĪJ70ə]޷rvnt-q[b.1ƳvxԘ=V&A oþSl~=|n-5`[g=x<夌Gs^kq9?Uu*_Ӄ ^~VKYӰLwZy~8lG1i|qI!t˫{,2Xu+=?Bl8RpsԾ]` TwqϴndI|[\z?ˡaU^XTK;*dr/.5C]WKձ~Lٯ;왵aqfJԓݭw8(9g[3.y&X)/^T͸+%j<phQrFzי|`&kmh8dϾۋ[gMu<u`Ruk{8<ܵTmK܂6ٶzX]5d@ywu.S+J}1Õgv'SǑqYYb֣J|Kk-_辴[;>'MV~VP%  ?'#SQJd3 <6|<%6=uGje^Ʀ/N0rN[,BK띷 5zu^S=O؋#6n2@Yqzvne[?u/cayW?֤#z&=68dثw=4rWy1g̨_#0Ɠ8viu#Ĺ;t17n`mhq{iK̸ZG| ;_b'~$\ C0C)C3#jQ)#xt '8a{jqËʝ&Q4ww'I>| ̵ 8j. s"c~A|X4N1h$=ff{uLbƄY)@e&U&e8`203ReaHeHgHdag(*g2$3Ty]\  #m!Rzo+&0yLi*y&Lӱqbn}/NYw_sJKǦLv 3撔g f?cӜVz镭S,L9b[QYvل/՘ܴu ^gی_zShkeGx&sfE͘ˁnX_k>Ouo/̷~|ܟ8:6xy[<-q:vM7ovFXKo㞎BMy˷v`e[ƨad/}`ׇ2˞:h.>vX6lz[|[8K٥/Mv|>ݎ"Ry}[?9&Ͳq>wRL0fچk F~C`fͣg/w-3=viѢUUJ<ʯuޏ۽?z]Z!J 6+g>[OkWe47yŹa~•V)Vwh{ř%v/ p=trvY4WGf * 8kIJe#Aԁ"F4>Dlȃ<tmg,+jb,ڼmu ^Tp:I=eӃ i1 3Yՠ XE,If'`Fetx"PPAg,O/J,ȨT@Ylo 7]?ҳ`M]?auĵd6{j 6OwΞmfYˌ"7ġQ@.sy#|ս28zpzhL-bc> stream x\/3ҥKQ,E0bAP *X. X^`Tcdžh,أ!vL^FygTro{}sδ3% !Đ~D#89h3!2$8S;^Apoag^EևǥJ3A.zP\RFo"؛ڳlZDif%9M)9 ̻It_$ɤWjeW]m`3޴OIlYHAH)qҶmr;JGg%t"8M*0ydg*z|?~yBv98G뛳]g$xxji39Lݽ ~^<>t4Wp82-7^ߒ>X7m/ mhAJ6Z$EԈɣgiG@#1<"wj̔pn Ec?M="oJZR}8:EG,{!!,s-A4'&PnM6: dig7Ѝ,FxgFiA\itToA[;ev0덞t`DݒCK,_RS%*XU!_U!_%UW ƥ!5RI :i]D-zO ĐSzZ+b÷|v9]_8QzXċy5t]/Hr w6UMs\NF1=G%G~Fѽ:!f>^&^Ԩ=5қi\×.W2q[[YhjELpREנ{;vj42=a4ͫtu-ZZHIE6uq9Оyze ƶS[\rH?it}z6D"{'v^fKx;9؋LM<ۥE:zfL#SS## ړx2;$R{aҮWTh`>Z_O54Łt$+$KAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAq!XfNfl!MeQvuEѭVHCjOϗEoTeuUNUYCU>*k= Me0҂Il* jĜj*?Zy*4koBUY?HU6eCll}U˦[R-uilfeGƗ5Xo7V0вY;۬hvu-*7;'Ӭ]wGŃRdqJEz<.S*oq>—B+d2E,>B"R2E<=MI"xYT,NO&Ӥ2L' J$Z%9.~NG%x &>:#kt[r^""It|y mnt?2GPi9Қ;q% iOC܈'h|Tt:W->t_tRlO{(}Q!~&,2i;T1ݫ;ݷDV)R LoHn~(XIued;Ϫ3ڰvR}^N]CAgਰYF\Z$,t][Q[za?OKHԜ߷_Jįqsg"9De=^0=>ߟ3zի4ܣ~2'LCЖ˗?(Z$T-Zf}ow_I8O$IDo VРZd%" Ék%kZFx01kšf9R֖v=:X'5̶a۲.+ƺ,JXO֋f}12jQg4-ƵqN@A X"!)%- … ;;DŽwj-T߅iNқ΍O+W`,l;)d+]F]PZ`ْ6Fi\Zj\D\?εYUMW%ĒLNR(ԉglg~JYA]}3^.-0 V*0~û+Y~*F;?UIaVd$ 1N,S)S21g7ie)biDj"25g7h76 OI4-g/6-ңHS3iLxrޜ 3] _i~Ѭ#$fI[ )4Wq8w צ@%p"['Z7?+0zk ݼ /'+z5I}޾D鞊xկk*'pM|R}g~:jt}s7Jz2vO[eH~2RGW%+-~wwSj[ !q.7Z,>)ԍr;1۫pΫIko]vʴ&SZ}eEh|]+;؏ԩI>e-%Jmf'_V23_Ѿz~닲?ܥF oJwRXS- "i+VMMaXgΉsPIIJeqtgvDt&`ٲ_p~\RRI\qmx4TZ+պi}Pk7b =u^[rfoNdD$n>^pWILY2_:ΪS5T =R;6(xВs&:څeHL+rT߯i~4Yۓ^zeb%U~jػq/N,}ᖖ~_uI@p>ֽ6EjCK>9cԿxPέNuP~L!W&N0J2eqNkߪ慬w;1g^Z}ͥ?R+a9Wg[MajS+/Y_S&oZ'7sUxZ&i>2BmY|.K~mS̼,*ԷdLO]κVi5]mv3t^g}T[oZv/Mo9}Ѣ]\w}.r\mGXt%7ݒ\[R-)x3rm9RRInqRg];P_Ck9G vg69ĉC[oxgW,g 9W}-64޾'3Dokw, _oԯV?kT>=UuiQ~Y[X9\ʊclz5>Y!W#F.(<5qV ;H= 6T{g|wɌyVo-7?ޣ\C+?Ku]>3"{`nSX 3ֶUs|K̘H?5C!@ԐEg:_ߥc6LQb6bI>8EzfzRppV+~Iog3Zd)re?<$m<9_)ɸirLo5Ž+_R.4_=ty.hŧ|=j [K΍u̹3>$EpݧSTV'kۯc|KRK-6E[;h8/[s{ ㌇GɖYZh}mB׿[ `~|5\[P@4V~? ѶCMG_]W~㉯VY(bkw?֨綈&"e4iXaKyOg<+:gόce__\Q<8e,f粥:.y[vOGu*>w0hMH{G6dze#v: qؽ1ֶ?X V<ɻ&:+GzܶUl0q;|Wz#Q׳Kko7Zj#.tΊ{d_Z+Zٹ +3.~Q87k٪Kp>lhz0(l?4xPPzׇԐ _oo7Oxvd0 _7IQ@IB_6eiz}kz҃k:pv_âxz)q$GHrxN}~{αv'z{f7rpqGxynӴoRphw?L0#²xfr鹂$et Cзq8u#x?O^ELc][^rѡGR`E5޿cʫ齏!sZUjaot_J1>V9GM9\^ EM/&t|UZ`MYVrD͗mLּZ~XhE_IzQwt>>`qB:kv_מxO[Ln?hz-q 8U׿㷞-d^5sϽ45l}![&9-xy^g_m(ZUO_ִ3E^ћ5 ԼPf8iI/=FXBBw2>}oKوV}*|,Gǔ?zxz۩LrxE庢U7ُ>rdEC~ᰤyZG>`L-^N+c9eӊO]9 2N^5$tPKvr{Gn}9h;aG.E,J]4d} xaʮj[d3'}t=n'7p(NR^Kh덛_y39:n[>mO\9q?uovpUw.?Hԅw+f~zMDӮiKZp͗p6d%=zu!mFת%Ebm#K_r9I%!DFb2$IwISgeeNFzBOlC佷(Jc5lv"u5QC~,]d@SȔs['DM0Xq yF漬rlW֮)K{]zұv.:tn3*C-Y?I;MP[霷1ͬXcH][zwK'-}n1jmak0.R o{ ~Ʈc4Q;pBSu}۹厙zAgC>o=&5hRbﲅ:e>:ތۻbwq-[kr7 cP/$0irN#өH:̛_kڟ+%j=ﻄp~xR3d+'_6"x^A#\={qqc ^/*v]vstW]|x3\KQnx\ Ηܜ{#X|jҳmK-zg[9&fY5%NV3xhɍ<7C2A4AA5EF3CD54D99A41C79FF9BCEF8>] /Filter/FlateDecode/Length 504>> stream x5eS@PDn[ї{t?3;w{v#h= F",@̗@@@¡@h@"J@ޱ|GR, (HM /CŁ#?S#_ JE/ qȁG.$ 7Iȋ|ȏ(˜("(b((HA2ʢ ʣRQP uQP5Q5PPQPM mhh脮HG7DA_d`?a cb8aF`$`4bc"&` &a2a*cf`.>`)cbc`cVb`Vcb=vb#6cb cv va72{ppGpp'p'q8 8󸄋븆۸;x{xxxxxxxxwiaM d< MLr:#3خĭX#$ endstream endobj xref 0 251 0000000027 65535 f 0000000017 00000 n 0000000125 00000 n 0000000195 00000 n 0000000460 00000 n 0000001789 00000 n 0000001954 00000 n 0000002201 00000 n 0000002329 00000 n 0000002357 00000 n 0000002514 00000 n 0000002588 00000 n 0000002836 00000 n 0000003011 00000 n 0000003257 00000 n 0000003427 00000 n 0000003668 00000 n 0000003935 00000 n 0000007622 00000 n 0000007802 00000 n 0000008046 00000 n 0000008221 00000 n 0000008460 00000 n 0000008728 00000 n 0000011986 00000 n 0000012153 00000 n 0000012401 00000 n 0000000028 65535 f 0000000029 65535 f 0000000030 65535 f 0000000031 65535 f 0000000032 65535 f 0000000033 65535 f 0000000034 65535 f 0000000035 65535 f 0000000036 65535 f 0000000037 65535 f 0000000038 65535 f 0000000039 65535 f 0000000040 65535 f 0000000041 65535 f 0000000042 65535 f 0000000043 65535 f 0000000044 65535 f 0000000045 65535 f 0000000046 65535 f 0000000047 65535 f 0000000048 65535 f 0000000049 65535 f 0000000050 65535 f 0000000051 65535 f 0000000052 65535 f 0000000053 65535 f 0000000054 65535 f 0000000055 65535 f 0000000056 65535 f 0000000057 65535 f 0000000058 65535 f 0000000059 65535 f 0000000060 65535 f 0000000061 65535 f 0000000062 65535 f 0000000063 65535 f 0000000064 65535 f 0000000065 65535 f 0000000066 65535 f 0000000067 65535 f 0000000068 65535 f 0000000069 65535 f 0000000070 65535 f 0000000071 65535 f 0000000072 65535 f 0000000073 65535 f 0000000074 65535 f 0000000075 65535 f 0000000076 65535 f 0000000077 65535 f 0000000078 65535 f 0000000079 65535 f 0000000080 65535 f 0000000081 65535 f 0000000082 65535 f 0000000083 65535 f 0000000084 65535 f 0000000085 65535 f 0000000086 65535 f 0000000087 65535 f 0000000088 65535 f 0000000089 65535 f 0000000090 65535 f 0000000091 65535 f 0000000092 65535 f 0000000093 65535 f 0000000094 65535 f 0000000095 65535 f 0000000096 65535 f 0000000097 65535 f 0000000098 65535 f 0000000099 65535 f 0000000100 65535 f 0000000101 65535 f 0000000102 65535 f 0000000103 65535 f 0000000104 65535 f 0000000105 65535 f 0000000106 65535 f 0000000107 65535 f 0000000108 65535 f 0000000109 65535 f 0000000110 65535 f 0000000111 65535 f 0000000112 65535 f 0000000113 65535 f 0000000114 65535 f 0000000115 65535 f 0000000116 65535 f 0000000117 65535 f 0000000118 65535 f 0000000119 65535 f 0000000120 65535 f 0000000121 65535 f 0000000122 65535 f 0000000123 65535 f 0000000124 65535 f 0000000125 65535 f 0000000126 65535 f 0000000127 65535 f 0000000128 65535 f 0000000129 65535 f 0000000130 65535 f 0000000131 65535 f 0000000132 65535 f 0000000133 65535 f 0000000134 65535 f 0000000135 65535 f 0000000136 65535 f 0000000137 65535 f 0000000138 65535 f 0000000139 65535 f 0000000140 65535 f 0000000141 65535 f 0000000142 65535 f 0000000143 65535 f 0000000144 65535 f 0000000145 65535 f 0000000146 65535 f 0000000147 65535 f 0000000148 65535 f 0000000149 65535 f 0000000150 65535 f 0000000151 65535 f 0000000152 65535 f 0000000153 65535 f 0000000154 65535 f 0000000155 65535 f 0000000156 65535 f 0000000157 65535 f 0000000158 65535 f 0000000159 65535 f 0000000160 65535 f 0000000161 65535 f 0000000162 65535 f 0000000163 65535 f 0000000164 65535 f 0000000165 65535 f 0000000166 65535 f 0000000167 65535 f 0000000168 65535 f 0000000169 65535 f 0000000170 65535 f 0000000171 65535 f 0000000172 65535 f 0000000173 65535 f 0000000174 65535 f 0000000175 65535 f 0000000176 65535 f 0000000177 65535 f 0000000178 65535 f 0000000179 65535 f 0000000180 65535 f 0000000181 65535 f 0000000182 65535 f 0000000183 65535 f 0000000184 65535 f 0000000185 65535 f 0000000186 65535 f 0000000187 65535 f 0000000188 65535 f 0000000189 65535 f 0000000190 65535 f 0000000191 65535 f 0000000192 65535 f 0000000193 65535 f 0000000194 65535 f 0000000195 65535 f 0000000196 65535 f 0000000197 65535 f 0000000198 65535 f 0000000199 65535 f 0000000200 65535 f 0000000201 65535 f 0000000202 65535 f 0000000203 65535 f 0000000204 65535 f 0000000205 65535 f 0000000206 65535 f 0000000207 65535 f 0000000208 65535 f 0000000209 65535 f 0000000210 65535 f 0000000211 65535 f 0000000212 65535 f 0000000213 65535 f 0000000214 65535 f 0000000215 65535 f 0000000216 65535 f 0000000217 65535 f 0000000218 65535 f 0000000219 65535 f 0000000220 65535 f 0000000221 65535 f 0000000222 65535 f 0000000223 65535 f 0000000224 65535 f 0000000225 65535 f 0000000226 65535 f 0000000227 65535 f 0000000228 65535 f 0000000229 65535 f 0000000230 65535 f 0000000231 65535 f 0000000232 65535 f 0000000233 65535 f 0000000234 65535 f 0000000235 65535 f 0000000236 65535 f 0000000000 65535 f 0000015878 00000 n 0000015978 00000 n 0000021178 00000 n 0000022611 00000 n 0000072778 00000 n 0000072821 00000 n 0000072849 00000 n 0000149966 00000 n 0000150026 00000 n 0000229856 00000 n 0000229954 00000 n 0000229982 00000 n 0000230010 00000 n 0000237154 00000 n trailer <<7C2A4AA5EF3CD54D99A41C79FF9BCEF8>] >> startxref 237861 %%EOF xref 0 0 trailer <<7C2A4AA5EF3CD54D99A41C79FF9BCEF8>] /Prev 237861/XRefStm 237154>> startxref 243041 %%EOF